SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11967
Pre Gene Modal
BGIBMGA013783
Annotation
AF461149_1_transposase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.216
 

Sequence

CDS
ATGGAGTGGACGCTTAAAGAAGACCGTGTTGCAGTTATTGCGTTGCATCGTTGCGGTTACGCGCCAATTCAAATTTTTAACATACTGAAAAATTTGAATATAACCAAAAGATTCGTTTATCGTACCATCAAACGATACACTGAAGACTCTAGTGTAGATGACAGGTCAAGAAGTGGTCGGCCTCGGTCTGTTAGGACTCCAGCAGTGATAAAAGCTGTGAAGGCGCGAATTCAAAGAAATCCCAAACGTAAGCAGAAACTGTTGGCCCTTCAGATGGGGTTAAGCAGAACCACGGTGAAAAGGGTGTTAAATGAAGACTTAGGGCTTCGGGCATATCGAAGAAAAACAGGACATCGTTTGAATGCTCGTCTAATGGACCTGAGACTGAAGAGATGCCGCGCTTTGTTGAAGCGGCACTGGGTATTCCAACAAGATTCGGCGCCAGCTCATAGAGCGAAGAGCACACAAGACTGGCTGGCGGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCAGATTTGAATCCGTTAGATTACAAGATATGGCAACACTTGGAGGAAAAGGCATGCTCAAAGCCTCATCCCAATTTGGAGTCACTCACGACATCCTAG
Protein
MEWTLKEDRVAVIALHRCGYAPIQIFNILKNLNITKRFVYRTIKRYTEDSSVDDRSRSGRPRSVRTPAVIKAVKARIQRNPKRKQKLLALQMGLSRTTVKRVLNEDLGLRAYRRKTGHRLNARLMDLRLKRCRALLKRHWVFQQDSAPAHRAKSTQDWLAAREIDFIRHEDWPSSSPDLNPLDYKIWQHLEEKACSKPHPNLESLTTS

Summary

Pfam
PF13358   DDE_3
Interpro
IPR009057   Homeobox-like_sf        + More
IPR038717   Tc1-like_DDE_dom       
SUPFAM
SSF46689   SSF46689       
PDB
5CR4     E-value=3.27476e-06,     Score=118

Ontologies

Topology

Length:
208
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.45144
Exp number, first 60 AAs:
1.45126
Total prob of N-in:
0.14261
outside
1  -  208
 
 

Population Genetic Test Statistics

Pi
30.662582
Theta
30.710484
Tajima's D
1.075537
CLR
0
CSRT
0.685365731713414
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号