SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11963
Annotation
PREDICTED:_uncharacterized_protein_LOC101735858_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 2.612
 

Sequence

CDS
ATGGTTGCTACTACTGGGGAACTGATACGTGGTAAGTTTAATCTTGAAAATCGCGCTACTTTTAACGTTTGTCATGTAAACGCGCAAAGTATAGCTAGTCACTACAGTGAACTAGATGTAACTTTCACCGACGCCAACGTGCACGCCGTCCTTGTTTCTGAGAGCTGGCTCAAACCTCATCTTCCTTCCGCCGCATACCCCCTACCTGGATTTATTCTAATCCGAAATGATCGGGTGGACAGGAGAGGGGGTGGTGTGGCTATCTATCTCCAAGCCTCCTTTTCTTATAAAGTCATAGCCTCTTCCTCTTCCACGAGTTCCAATTCCGCTGAATACCTTTTCCTTGAGGTTTGGGTCAAGGGAGTCAAAACTTTACTTGGTGTGGTTTATTGTCCTCCCTCTGTTGATTACTTCTCCAGTCTTGACTCAACTCTGGAATCTTTAGGGTCAGATTACGCACACCACATCATCATGGGAGACTTCAACACCGACCTCCTTGTCCCTTTGTCCACTCGTTCACGAAAACTCCTTGACCTTGTTGAGTCAGTCAGTTTACACATCCTCCCTTTACAAGCCACTCACCACAACATTGAAGGAGAGGATACCTGGCTTGACCTAATACTCACTTCCACTCCCGATCTTGTTCATTCTCACGGTCAGTTTCCTGCTCCTGGTTTCTCCCATCATGACCTCATTTACTTATCCTACGTCCTTAAACCTCCCAAATCCAAGCCTAAGGTTTTGCGCGTGCGTTGTTTTGGTCGCATGGATGGACGCAAGTTGTGTGAGGATGCTGCTAAAATTACTTGGGATGAACTGACGGCAGCTACATCTATTGACGAGAAGGTGACTATATTTAACGCTCAACTCCAGGCACTTTATGACACTCATGCTCCCGTCAGGAAATTCAAGTTGAAACGTCCTCCAGCACCTTGGATGACGAGTGAGGTTCGGATGGCGATGAAGCGTAGGGATCGGGCCTTGGCAAAATTCAGGAGACGCCGCACGGAGGAAAACTGGACATCATTTAAGGTTGCGAGGAATTGGTGTAATCAGATGGTACGGAACGCTAAGCGCCGCCATATTCTCGAAAATATAACCTCCGCTTCTTCAGCTAATATCTGGAAGTTCCTTAAGACTCTGGGTATTGGTAGAGAGAAGAATAAAGACTTCCAGGGGACCGTTGCCTTAGATGACCTTAACAGGCATTTCAGCGCATCTGCCGGCATTGATCATCAAGTCAAAAGTCTCACTATTGAATTTATAGCTGGGTTACCTAAACCAGACATTGACCCCTTCCAATTTTCTCCAATGACTTCAGATGATATTAAAAAGATTATCCTATCCATTAGATCTAATGCTGTTGGTTATGACAAAATCACCCGTCGCATGATTACCACAGCTTTAGACCATCTTATTCTCACCATAACCCACATCATTAATTTCTCCTTTAGTACCGACATGTTTCCCTCCCAATGGCGTAAGGCTTATGTCATTCCTCTTCCTAAAATACCGAATCCTACCCTTGTTACTCACTTCCGACCTATATCCATACTTCCTTTCCTATCTAAGGTTTTAGAATCTTGTGCGCACAAACAACTGTCTAACTTTATTCATTCACACAATTTATTGAGTACACTGCAGTCCGGTTTCAGACCTTGCCACAGCACTACTACCGCACTCCTTAAAGTGATTGGCGATATTAGAGCAGGTATGGAGGACACAAAGGTTACGGTATTGGTTCTGATAGACTTCTCAAACGCTTTTAATAACGTCAATCACGACATCCTCTTATCCATTCTCTCCCATCTTGGGATGTCATCTGGAGCATTGGATTGGTTCTCGTCCTATCTTCGAGGTCGTCAGCAGTCGATACACATCGGCGAATCTTCGTCTAGTTGCTTTATGCTCAGGCTGGAGTCGATAGTGTGTCTTCGGCAGTTGGAAAAATAA
Protein
MVATTGELIRGKFNLENRATFNVCHVNAQSIASHYSELDVTFTDANVHAVLVSESWLKPHLPSAAYPLPGFILIRNDRVDRRGGGVAIYLQASFSYKVIASSSSTSSNSAEYLFLEVWVKGVKTLLGVVYCPPSVDYFSSLDSTLESLGSDYAHHIIMGDFNTDLLVPLSTRSRKLLDLVESVSLHILPLQATHHNIEGEDTWLDLILTSTPDLVHSHGQFPAPGFSHHDLIYLSYVLKPPKSKPKVLRVRCFGRMDGRKLCEDAAKITWDELTAATSIDEKVTIFNAQLQALYDTHAPVRKFKLKRPPAPWMTSEVRMAMKRRDRALAKFRRRRTEENWTSFKVARNWCNQMVRNAKRRHILENITSASSANIWKFLKTLGIGREKNKDFQGTVALDDLNRHFSASAGIDHQVKSLTIEFIAGLPKPDIDPFQFSPMTSDDIKKIILSIRSNAVGYDKITRRMITTALDHLILTITHIINFSFSTDMFPSQWRKAYVIPLPKIPNPTLVTHFRPISILPFLSKVLESCAHKQLSNFIHSHNLLSTLQSGFRPCHSTTTALLKVIGDIRAGMEDTKVTVLVLIDFSNAFNNVNHDILLSILSHLGMSSGALDWFSSYLRGRQQSIHIGESSSSCFMLRLESIVCLRQLEK

Summary

EMBL
NWSH01000817    PCG74070.1    NWSH01000893    PCG73654.1    RSAL01000177    RVE45007.1    + More
RSAL01001570    RVE40758.1    GEBQ01020572    JAT19405.1    LBMM01014048    KMQ85356.1    LBMM01010997    KMQ87090.1    GBHO01012041    GBHO01012038    JAG31563.1    JAG31566.1    DNUT01000507    HBI41157.1    GEBQ01030598    JAT09379.1    DMQF01000352    HAO15199.1    DMQF01000361    HAO15230.1    GANO01004094    JAB55777.1    GEHC01000909    JAV46736.1    GEHC01000896    JAV46749.1    QOIP01000011    RLU16479.1    QOIP01000005    RLU22413.1    GEHC01000940    JAV46705.1    GANO01004066    JAB55805.1    GEHC01000892    JAV46753.1    DMQF01000003    HAO13943.1    DMQF01000030    HAO14052.1    QOIP01000004    RLU23301.1    DNUT01000056    HBI39512.1    DMQF01000478    HAO15711.1    GEBQ01006447    JAT33530.1    DNUT01000170    HBI39961.1    GBHO01002973    JAG40631.1    GEZM01041318    GEZM01041317    JAV80524.1    GANO01004275    JAB55596.1    GAMC01021037    GAMC01021036    JAB85519.1    LSMT01000554    PFX16333.1    DNUT01000297    HBI40414.1    GEZM01051381    GEZM01051380    JAV74995.1    DNUT01000374    HBI40695.1    GEHC01001026    JAV46619.1    GANO01001936    JAB57935.1    LSMT01001965    PFX11729.1    LSMT01000121    PFX26660.1    DNUT01000451    HBI40968.1    GAMC01021038    GAMC01021033    GAMC01021031    JAB85522.1    GEZM01074146    JAV64657.1    GEZM01061184    JAV70703.1    GEZM01061183    JAV70704.1    NWSH01001817    PCG70032.1    NWSH01000010    PCG80923.1    GANO01004361    JAB55510.1    GEZM01074147    JAV64656.1    LBMM01006440    KMQ90605.1    AAGJ04020328    AAZX01023386    AAZX01004038    GEZM01061182    JAV70705.1    GEZM01061185    JAV70702.1    GANO01004238    JAB55633.1    KZ150070    PZC74075.1    LSMT01000021    PFX32582.1    NWSH01006271    PCG63543.1    DMQF01000157    HAO14486.1    JXUM01065503    KQ562350    KXJ76100.1    GEZM01008907    JAV94684.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF06441   EHN
PF03372   Exo_endo_phos
PF18701   DUF5641
PF05380   Peptidase_A17
PF00665   rve
PF17917   RT_RNaseH
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR000477   RT_dom       
IPR005135   Endo/exonuclease/phosphatase       
IPR000639   Epox_hydrolase-like       
IPR010497   Epoxide_hydro_N       
IPR029058   AB_hydrolase       
IPR001878   Znf_CCHC       
IPR011011   Znf_FYVE_PHD       
IPR021109   Peptidase_aspartic_dom_sf       
IPR040676   DUF5641       
IPR041373   RT_RNaseH       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF53474   SSF53474       
SSF57903   SSF57903       
SSF53098   SSF53098       
SSF50630   SSF50630       
Gene 3D

Ontologies

Topology

Length:
650
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.3132
Exp number, first 60 AAs:
0.000610000000000001
Total prob of N-in:
0.00235
outside
1  -  650
 
 

Population Genetic Test Statistics

Pi
239.864825
Theta
129.871034
Tajima's D
4.574526
CLR
0.285186
CSRT
0.9998000099995
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号