SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11937  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA004468
Annotation
PREDICTED:_inactive_dipeptidyl_peptidase_10_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.293
 

Sequence

CDS
ATGGTACTTATAAAAGATAAGTCGACTTCTAGAAACATCGCAGATCTTAACGTGGCCTGTCTTGGTGCTATAAATATGAAGTTCTTGTTGGTTATACCGATGTGCGTGCTGGCTGCCGGCGGTGGTCTCCTCGACGTGGATGTCGATATTTTATCCGCACCGGATAAAATCGAAGCGGATAACCTATATAGCAGTGTCATCACCGGTGACATTGACAAAGCTGTGGTCCAAACTTTGGCGCTCAACCTACTATCAAAAGGAGCCATCATCGAAGATGTCATTGCCAGGCTCATTAGAGATAAAAAGCGAAACATCTTCGACTATGCCTATAAACTATGGAACGGTGAAGGAAAGGATGTCGTCAAACAACACTTCCCTATGCAATTCAGACTGATCTTTGCCGAGAATCATGTCAAGATCATCAACAAGAGGGACAATCTCGCCATTAAACTCAGCACTGAGGTGGATCACCAAAATGACAGATCTGCATTTGGTGACGCGAACGAAAAAACCACTGACAACGTCGGCTGGAGGTTTGTCCACTTGTGGGAAAACAACAAGGTTTACTTCAAGATCGTTAGCGTTGCCCGTAACCAATTCTTGAAACTGGGTACTGATGCTGACGAAGCTGGCGACCACATCGCTTACGGTGCCGACGTGGCTAACACCTTCAGACACCAGTGGTACCTACAGCCTGCCAAGTACGAAGACGACCTTCTTTTCCTCATTTACAACCGCGAATTCAACCAGGTTCTGAAGCTCGGTCGAGTAGTCGACAACATGGGTGACCGACAAGAAATTTTGGACAGTCGAACAGCACTGTGGATGTCTGCTGATGGCCACATGGTATTGTATGCAACCTTCAACGACAGCCTCGTTCATGAGCAGAAGTTCCCCTGGTACGGCGCCGCGCTGGACACGGATGACCCTGAAAAGACATATCCAGAAATTAAGAGCGTGAGATACCCGAAGCCGGGTACCAACAACCCAACATTTACTTTAACAGTGGCGGATATCGCAGACCCTAAACATATAAGGACCAGACATTTGACGCCACCCAAAGTTATACTAGAACAAGGAGATTACTACTTCACAAGCGCGCAATGGGTGTCGTTGACTGAGGTATGCGTTGTTTGGCTCACGAGGGTCCAGAATCTGTCTGTCGTATCAGTTTGCAAGATCCCGATGTGGTTCTGTCAAGAGGTATACCGAATATCGTCAAGCAACGAAGGCTGGGTCGAATCCGCACCGGCGCCATTGTGGTCTGCAGGAGGAGGCGCACTGGTAACGCTTGCCCCAGTAAGAGACGGCCCGGCTGGTCTCTTCAGACACATCGTGAGGACTGAACACAATTCACACGGACCAAGGGCGTTACCTCTGACTCATGGTAGCTTCGACGTCGTGAAATTATTAGCGTGGGATCATGCGAACCAGCACATATATTACCTCGGCATACCAGAAGGCAAACCAGGGCAACAGCATTTATACAGGGTATCGTCTGAAGCGCCCAGACCAGGCTCACCGCAAAAACTGCCTTACTGCGTCACTTGCAATTCACAGCCTTCTCCGTCAATAAGTTTGGAGTATTACGGTAATTTGGCGTCATCAGGAGAAAGTAATTGGGACAACGATTGGGACGAAGAGCTGCCAACCACTTCACCTTCGCCCACTAAAAAGAAGAAAAGGCGACATCCAGAGGGTGTGCCGCAGAACTTGCCTTGTTTGTATCACGAGGCACACTTCAGTCCAACGGCGGCGTATTTCGTGCTGGAGTGCCTCGGTCCCGGCGTTCCGACGTCAAGCCTCCACAAGACCGCGCTTCCGGAACCAAGACTAGTCATGCACTTGGAAAACAATACGGTTGTGAAGGAGCGACTGTCGTTGATAGCGCTGCCCACACCGAGAACGTTCTCGGTTCATTTGTCCAGCGGACACCAAGCCCGGGTACGCCTGCTTCTACCACCGGGTCTTAGAGAAGACGAAGTTACCAAGTACCCTCTGGTGTTAAAAGTGCACGGAGCTCCAGGTAGCCAGCTTGTGACAGAGCGCTGGGCTGTTGACTGGGGGTCATTGGCCGCTGGTGCCGGGGCCATTGTGGCTACGGTTGACGCCAGAGGGGCTGGCGGCAGAGGCTTAGGAGCTCACCATGCTCTGCATAGAAGACTGGGGACCGTAGAGTTGCAAGATCAACTGGAAGTGGCCGAGTATCTTCGTGACTCCCTGCACTTCATAGACGCGCGCCGTGTGGCGGTGTGGGGGCGGTCGCATGGCGGTTTCCTGGCGACAATGGCGCTCGCGAGCACGCCCAGCGTCTTCCACTGCGGCATCGCAGTCACGCCTATCGTGCGCTGGCGTTACTACGCGTCAGCATACGCTGAGCGTTATATGGGCTTTCCAAACGCAACGGGCAACTACAGAGGCTACGCTGAAGCTGACGTCACCAAGCAAGCGGCGGCCTTACACGACAAGATGCTGCTGCTAGTACACGGCACAGCAGACGACAGTGTCCATATACAGCAGACTATGGCATTGGCAAGGTCATTGGCTGAACAAGGCAGCATGTTCCGGCAGCAGATTTACCCGGATGAAGGTCACAGCTTGGAAGGCGTGAAACATCACTTATACCGCACGATGTCTTCGTTCCTCGACGACTGCTTCAGGAAGCAGGTTCCTCCCGAGACCAAGGCGGGACTCAGGAACGGCGGAAACCTTGACTGA
Protein
MVLIKDKSTSRNIADLNVACLGAINMKFLLVIPMCVLAAGGGLLDVDVDILSAPDKIEADNLYSSVITGDIDKAVVQTLALNLLSKGAIIEDVIARLIRDKKRNIFDYAYKLWNGEGKDVVKQHFPMQFRLIFAENHVKIINKRDNLAIKLSTEVDHQNDRSAFGDANEKTTDNVGWRFVHLWENNKVYFKIVSVARNQFLKLGTDADEAGDHIAYGADVANTFRHQWYLQPAKYEDDLLFLIYNREFNQVLKLGRVVDNMGDRQEILDSRTALWMSADGHMVLYATFNDSLVHEQKFPWYGAALDTDDPEKTYPEIKSVRYPKPGTNNPTFTLTVADIADPKHIRTRHLTPPKVILEQGDYYFTSAQWVSLTEVCVVWLTRVQNLSVVSVCKIPMWFCQEVYRISSSNEGWVESAPAPLWSAGGGALVTLAPVRDGPAGLFRHIVRTEHNSHGPRALPLTHGSFDVVKLLAWDHANQHIYYLGIPEGKPGQQHLYRVSSEAPRPGSPQKLPYCVTCNSQPSPSISLEYYGNLASSGESNWDNDWDEELPTTSPSPTKKKKRRHPEGVPQNLPCLYHEAHFSPTAAYFVLECLGPGVPTSSLHKTALPEPRLVMHLENNTVVKERLSLIALPTPRTFSVHLSSGHQARVRLLLPPGLREDEVTKYPLVLKVHGAPGSQLVTERWAVDWGSLAAGAGAIVATVDARGAGGRGLGAHHALHRRLGTVELQDQLEVAEYLRDSLHFIDARRVAVWGRSHGGFLATMALASTPSVFHCGIAVTPIVRWRYYASAYAERYMGFPNATGNYRGYAEADVTKQAAALHDKMLLLVHGTADDSVHIQQTMALARSLAEQGSMFRQQIYPDEGHSLEGVKHHLYRTMSSFLDDCFRKQVPPETKAGLRNGGNLD

Summary

Similarity
Belongs to the peptidase S9B family.
EMBL
KQ459460    KPJ00695.1    KQ460009    KPJ18468.1    GEZM01085036    GEZM01085034    + More
JAV60299.1    KK852816    KDR15783.1    NEVH01017448    PNF24362.1    GECU01023630    GECU01014090    JAS84076.1    JAS93616.1    KQ971354    EFA07086.2    APGK01035170    APGK01035171    APGK01035172    APGK01035173    APGK01035174    APGK01035175    KB740923    ENN78213.1    GEDC01015891    JAS21407.1    KQ976892    KYN07226.1    GL451165    EFN79886.1    KQ982316    KYQ57844.1    KQ976565    KYM80540.1    GL888237    EGI64246.1    KQ981215    KYN44513.1    LBMM01000102    KMR04941.1    FX985544    BBF97878.1    DS232164    EDS36485.1    GL435343    EFN73439.1    DS235165    EEB12758.1    GBYB01006104    GBYB01006105    JAG75871.1    JAG75872.1    KK107261    EZA53922.1    QOIP01000012    RLU15804.1    KZ288210    PBC32919.1    APCN01000644    GAMC01017869    JAB88686.1    AXCN02000635    JXJN01023739    ATLV01014616    KE524975    KFB39244.1    JRES01000933    KNC27137.1    GBBI01004073    JAC14639.1    GFTR01008150    JAW08276.1    UFQT01000408    UFQT01001675    SSX24025.1    SSX31383.1    KQ414784    KOC61125.1    GAMC01017870    JAB88685.1    CCAG010002792    CCAG010002793    GAMC01017868    JAB88687.1    CVRI01000014    CRK89709.1    AAAB01008944    EAA10083.5    ADTU01002890    ADTU01002891    ADTU01002892    CH963857    EDW76193.2    ADMH02001599    ETN61886.1    AE014134    AY122228    AAF52407.3    AAM52740.1    CM000157    EDW87873.1    OUUW01000010    SPP85818.1    CH379062    EAL32882.2    CH479184    EDW37388.1    CH916372    EDV98959.1    CH954177    EDV59096.1    CH940649    EDW63321.2    CH933807    EDW13374.1    ACPB03005088    CP012523    ALC39260.1    CM002910    KMY88550.1    AHN54197.1    CH902620    EDV32176.1    KRT05034.1    KRT05035.1    KRJ97470.1    KRG03719.1    KRG03720.1    KPU73830.1    KPU73831.1    KQ435711    KOX79483.1    LNIX01000001    OXA63602.1    OXA63607.1   
Pfam
PF00930   DPPIV_N        + More
PF00326   Peptidase_S9
Interpro
IPR001375   Peptidase_S9        + More
IPR029058   AB_hydrolase       
IPR002469   Peptidase_S9B_N       
IPR038554   Peptidase_S9B_N_sf       
SUPFAM
SSF53474   SSF53474       
Gene 3D
PDB
1Z68     E-value=1.816e-72,     Score=696

Ontologies

Topology

Length:
905
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
22.99388
Exp number, first 60 AAs:
21.25191
Total prob of N-in:
0.93570
POSSIBLE N-term signal
sequence
inside
1  -  20
TMhelix
21  -  43
outside
44  -  905
 
 

Population Genetic Test Statistics

Pi
262.448311
Theta
171.87225
Tajima's D
1.449518
CLR
0.782601
CSRT
0.778961051947403
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26822097 DGVYDADSHSIQVYQAR 95.65 2e-09
25044914 IGTAYEDAVISNGIGAYMATPIIR 95.65 2e-09
24402669 SAEYNDIIDNTISEGKR 100.00 5e-06
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号