SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11933
Annotation
hypothetical_protein_[Piscirickettsia_salmonis]
Location in the cell
Mitochondrial   Reliability : 1.399 Nuclear   Reliability : 1.188
 

Sequence

CDS
ATGTATTGTTCTCCTAACCCAAAAAAAACTGATGAAAGTGTGGGCGGCAACACGGGCCGCGAAATATCTACGGCACCGTTTAAGGTGCCAACCGTAGCAGCAAAAGCTGTAAGATGCGAGAGCGCACTCTCGATGCGGTCGGGAAGTGCTGCTTCCGTGAGGAGTAGCGCCTCGAGTGACCGAGGGTCGCTCTCGGTAGATGAAATGAATAGTACGATTGTAGGAGGAAGAGCACTCCGCAAACGTAAAACGGCTCCGCGAGCGGCGGCTTCCCGCCCTTCTGACTCCTCGGAGGGGGAACCCGCACCGCCCGCGAAATTCCTCGCCTTAGAGGAAACCACGGCACCAGTCGGTGGTCGCCAGGTGGCAACGGACTCTGCCAGTGCAGAGGTCGAGCGACTCGTCCGCTCCCTCACCGAGGTGGGGTTCGAAGACTCCACAAAACTATTTAGGGTCGCCTCGGATATTGTATCCAGTGTGGCAGCCAAATCGGGCAGGGGTTTTAAGGGCATATACCTGCATGCTCTTAAGTGCTTGGCTGCCACAATTGAAGACTACCTAAACATAGTTACTCACAAGACGAGCGGCGAGAACGAGGAATGCGTGCGACTGCAGAGAGACCAGCTCAAGGCACAAAACGCCGAGCTGCAAAATAATAATCTTGAGCTACGGGCGGAGATCGCGACCCTACACATGCGGGTGGACGAACTCATGGCGGAGATACGTAGCCCGGCTCCACCCGATGTCGAGGAGGTAGCTGAGCTAAAGCGGCGGATCGCCATTTTAGAGGCGCGCAGTTCGCCAGTGGAGCGTGCAAGACCACTGCTCGCACACGAGCGGAGAGCTGGCACCCAGGTCAAGCCCCAGTCTGCCAAACAGAATAAGCAGCCTGCCAAGCACGATCAAACCCAGCCGACCACCCTGGCCAAGCTTCATGTAGCTAAGCAAGCCAAGGCCCAGCAGCCGGTCCCTACCAAGCCACAGCCTGCCGTAGCGCGTACTGGAAGGGACCGAACGAAGAAGAAAGGCGTGAATGCTGCCAAAGTGATGCAGTACCCTCAGCCCTGCCCGCTGCCTCCGGTCCCATCCAGCATGGACGTAGCGTGGACGACAGTGGTAAAGCGGGGACAAAGAAAGACGAAGGAAGGACAAAGAAGCCCTCGGTCTGTCCAGGCAGTTGCCGCTCCCCACGTAGAGGGTCCAGCGGTGAAGATACGGAAGAACCGTCGAGGAGGAAGATCCGGCAAGACACGCGCTCCGCGGTCGGCTGCAGTTGTTTTAGAATTGCTGCCGGCCGCTAAAGACAAGGGTATCACTTACGAAGAAGTGATGGCCCGGGCGCGTGGTGGCGTGGATATTGACGCCATCGGAGTGGAAGGCGGACTGAAGGTTCGACACACGGCTAACGGCGCTCGTTTGCTCGAATGTCCCGGTGCTGACTCAGGAGCGGTTGCGGACCGACTTATGGCCCGACTCCGCGAGATCTTGCCTGATCCGGAGGTGGTGAGGATCGACAGGCCTGTCAGAATGGCGGAGATCAAGGTGACGGGCCTGGACGAGTGCGCCATGAAAGAGGAGGTGGCTGCCGCTATCGCATTGCAGGGGAACTGTGCTCTTGCAAACGTCAAGGTGGGGGAGCTTCGGAGTACATATTCCGGAACTCGCTCTGTATGGGCGCGGTGCCCCGTACAGACAGCCAGCCCGTACTGGCTACGCCTGCACAGGGAAAGCCCGCTGACACGCCCGGTAGGCTACGCGTGGGGTGGGTCATTGCCCACGTGCAGTTGCAGGAAGCTCGACCATGGCGATGCCTTCGATGTTTCGGCACCGGGCACGGCCTCGCCAAGTGCTCGTCAGCTGTTGACCGCAGCGGACTATGTTTCCGGTGCGGCCAATCTGGGCACAAGGCCGCTTCCTGCACTGCCGCCATGCCACACTGTGTATTGTGCGACGCGGAGAAGCGGCGGGCCAACCACCGGGTTGGTGGCCCAGCATGTCATTTTACCTCTTTCTCATCCAAGAGGAGGAAGGGCGAATTTGAACCACTCCGCCAGGGCGCAGGATCTCCTCGTCCACACCATGGTGGAGTGGTCAATCGATGTTGCCATAGCCGCAGAGCCGTACTTCGTCCCTGCGGACCAGGATGCCTGGATCGGGGACGTCGACGGCTCCGTGGCTATTACTATCAGGCAGGCCGCGGCGTTACCCCCCCTGGTGATGGTGGCCAGGGGATCCGGTTATGTCGCGGCCAGGGTCGACGAAACCGTCGTGATCGGGGTATACTTCTCTCCGAATAGACATCTCGCCGAGTTCGAGCAGTTCCTGGGCGGGCTTGAGGTGTTGGTTCACCGCCTCGGGTCCCGCCCGGTTATCTTAGCGGGAGACCTCAACGCAAAATGGGTGACTTGGGGTTCCCCCCGCTCGGACTCACGCGGCAGGATGCTCTCGGAGTGGGCGATCGCGGCTGGTCTCTGTCTTTTGAACAGAGGTTCGGTCGCGACTTGCGTGCGATGGAACGGCGAATCTCACGTGGACGTGACATTCGCATCTCCGTCCATCGCACGCCGCACCCGTGGCTGGCGCGTTCTTGAGGGGGCGGAGACGCTCTCGGACCATCGATACGTCCGATTTGAGCTCTCAGCCTCCTCTCGATCCGCGTCGGCTATGAACGCCCGCGGTGAGGAGGAGCTCCCGCGAAGTGCTCCTCGGTCATTCCCCAGGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGGTGGAGGCAGCCACGGTGGCTGCGTGGGCACCCGTGCCTACTAGCCCCGTGGACGTGGAGTCAGAGGCTGACTGGTTCCGGGGAACGATGGGTCGTATTTGTGACTCAGCGATGCCCCGGGTAGGCAGCAATGCTCCGCGTGGCGGTGCGTACTGGTGGTCGCCCGAAATCGCGCAACTCCGCGAGGAGTGCGTGCGGGCGCGCCGCCGGAGCGCTCGCCATCGCCGCCGCCGCCTTCGCGATGAGGACTTCGCGGAGGTAGCGGACCGGTTGCGCGCCGACTGCCGCCAAAAGCAGGAAGCGTTGCGACTGGCCATCGGTGAGGCCAAATCTCAGGGCATGCAGACGCTCCTGGAGATGCTCGATCAGGATCCCTGGGGGCGCCCGTACCAAACGGTCCGCAAGAAATTGCGGCCGTGGGCGCTCCCAGTGACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGAGATTGTCTCCGGGCTGTTCCCGCAGATGGAGAGGGACTTTGAGCCTCCCTCCATGGGCGCGCCGCCTCGCAGTGACGTGAGCGGTATTGCTGAGGTGGTCCCTCCGAGCATTTTGGAGGAAGAGATTCATGCGGCCGTGTTGAGGATGCGGAGAAAAGACGCGGCCCCCGGCCCTGACGGTGTTCACGGCCGGGTCTGGGATTTGGCCTTCGGTGCCCTTGGGGACCGGCTCGTGCGGCTCTTTGAAGCCTGCTTCGAGTCGGGACGGTTTCCTAAGCAGTGGAAGACGGGCAGACTCGTCCTTCTGAGGAAGGAGGGGCGCCCCGCAGACTCACCTGCGGGGTACCGCCCCATCGTGTTGCTGGACGAGGCGGGAAAATTGTTGGAGCGAGTTATCGCCGCCCGCATCGTCCGGCACCTGACCGGGACGGGTCCCGATCTGTCGGAGGAACAGTATGGCTTCAGAGAGGGCCGCTCTACTATCGACGCGATTATGCGCGTGCGTGCCCTCTCTGACGAAGCTGTCGCCCGGGGTGGGGTGGCCTTGGCGGTGTCCCTGGATATCGCCAACGCTTTTAACACCTTGCCCTGGTCAGTGATCGCGGGGGCGCTCGAATATCATGGCGTCCCCGCGTACCTCCGCCGACTGATCGGGTCCTATCTCGAGGACAGATCGGTCGTGTGCACCGGACACGGTGGTGCGGTGCTCCGCTTTCCGGTCGAGCGCGGTGTTCCACAGGGGTCGGTCCTTGGCCCTCTCCTGTGGAATATCGGTTACGACTGGGCTCTGAGGAGCGCCCTGCACGGCCCTCTCCCGGGCCTAAGCGTTGTGTGTTACGCGGATGACACGTTGGTCGTGGCCCGGGGGAGGAACTACCAAGAGTCTGCTCGTCTTGCCTGCGCAGGGGTGGCATTCGTCGTCGGTAAGATCCGAAGGCTGGGCCTCGACGTGGCCCTCGAGAAATCCCAGGCCCTGCTGTTTCACAGGGCTGGGAGAGAGCCGCCACCCGGGGCCCACCTGGTGATTGGAGGCGTCCGCGTCGAGGTCGGGGTGACTGGGTTACGGTACCTCGGTCTCGAATTGGACGGTCGTTGGAACTTCCGCGCTCATTTCGAGAAGTTGGGCCCCCGACTGATGGCGATGGCTGGATCGCTGAGTCGGCTCTTGCCAAACGTCGGAGGGCCTGACACGGTGGTGCGCCGCTTCTACGTGGGGGTGGTGCGGTCTATTGCACTATACGGAGCCCCCGTGTGGTGCCGCGCCTTGACTCGCAGAAACGTCGTGGCGCTGCGACGCCCGCAGCGTGCAATCGCAGTCAGGGCGATTCGTGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCGTTCTCGCCGGGACGCCTCCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTATGCGTGGCGTTGTGACCTTCGCGACAGGGGGGAACCACGTCCCGGAGAAGGAGCAATTAGAGCGCGGAGGCTCCAATCTCGGCGGTCTGTGTTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGTCTCCGGACCGTCGAGGCGGTGCGCCCGGTCCTCGCGAAATGGGCGAACCGTGACCAAGGGCGTCTCACCTTCCGGTTGACGCAAATGCTTACCGGCCATGGGTGTTTCGGCCGGTACCTGCATCGCGTTGCCCGGAGGGAACCGACGATGGAGTGTCACCACTGTGACTGCGACGAGGACACGGTCGAGCATACGCTCGCATATTGCCCCGCATGGGTGGAGCAACGCCGTGTCCTTGTCTCGCAAATAGGACCGGACTTGTCGCTGCCGACTGTCGTGGCTACGATGCTCGGCAGCGATGAGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGAACGAGAGAGGGAGAGCTCATCCCTCTCCGCACCTATCCGTCGCCGCCGAGCCGGGGGCCGCAGAAGGGCTTTTGTCCGACTTCGGCCCCTGTAA
Protein
MYCSPNPKKTDESVGGNTGREISTAPFKVPTVAAKAVRCESALSMRSGSAASVRSSASSDRGSLSVDEMNSTIVGGRALRKRKTAPRAAASRPSDSSEGEPAPPAKFLALEETTAPVGGRQVATDSASAEVERLVRSLTEVGFEDSTKLFRVASDIVSSVAAKSGRGFKGIYLHALKCLAATIEDYLNIVTHKTSGENEECVRLQRDQLKAQNAELQNNNLELRAEIATLHMRVDELMAEIRSPAPPDVEEVAELKRRIAILEARSSPVERARPLLAHERRAGTQVKPQSAKQNKQPAKHDQTQPTTLAKLHVAKQAKAQQPVPTKPQPAVARTGRDRTKKKGVNAAKVMQYPQPCPLPPVPSSMDVAWTTVVKRGQRKTKEGQRSPRSVQAVAAPHVEGPAVKIRKNRRGGRSGKTRAPRSAAVVLELLPAAKDKGITYEEVMARARGGVDIDAIGVEGGLKVRHTANGARLLECPGADSGAVADRLMARLREILPDPEVVRIDRPVRMAEIKVTGLDECAMKEEVAAAIALQGNCALANVKVGELRSTYSGTRSVWARCPVQTASPYWLRLHRESPLTRPVGYAWGGSLPTCSCRKLDHGDAFDVSAPGTASPSARQLLTAADYVSGAANLGTRPLPALPPCHTVYCATRRSGGPTTGLVAQHVILPLSHPRGGRANLNHSARAQDLLVHTMVEWSIDVAIAAEPYFVPADQDAWIGDVDGSVAITIRQAAALPPLVMVARGSGYVAARVDETVVIGVYFSPNRHLAEFEQFLGGLEVLVHRLGSRPVILAGDLNAKWVTWGSPRSDSRGRMLSEWAIAAGLCLLNRGSVATCVRWNGESHVDVTFASPSIARRTRGWRVLEGAETLSDHRYVRFELSASSRSASAMNARGEEELPRSAPRSFPRWALKRLNKELLVEAATVAAWAPVPTSPVDVESEADWFRGTMGRICDSAMPRVGSNAPRGGAYWWSPEIAQLREECVRARRRSARHRRRRLRDEDFAEVADRLRADCRQKQEALRLAIGEAKSQGMQTLLEMLDQDPWGRPYQTVRKKLRPWALPVTERLQPQQLREIVSGLFPQMERDFEPPSMGAPPRSDVSGIAEVVPPSILEEEIHAAVLRMRRKDAAPGPDGVHGRVWDLAFGALGDRLVRLFEACFESGRFPKQWKTGRLVLLRKEGRPADSPAGYRPIVLLDEAGKLLERVIAARIVRHLTGTGPDLSEEQYGFREGRSTIDAIMRVRALSDEAVARGGVALAVSLDIANAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEDRSVVCTGHGGAVLRFPVERGVPQGSVLGPLLWNIGYDWALRSALHGPLPGLSVVCYADDTLVVARGRNYQESARLACAGVAFVVGKIRRLGLDVALEKSQALLFHRAGREPPPGAHLVIGGVRVEVGVTGLRYLGLELDGRWNFRAHFEKLGPRLMAMAGSLSRLLPNVGGPDTVVRRFYVGVVRSIALYGAPVWCRALTRRNVVALRRPQRAIAVRAIRGYRTVSFEAACVLAGTPPWDLEAEALAADYAWRCDLRDRGEPRPGEGAIRARRLQSRRSVLEAWSRRLADPSAGLRTVEAVRPVLAKWANRDQGRLTFRLTQMLTGHGCFGRYLHRVARREPTMECHHCDCDEDTVEHTLAYCPAWVEQRRVLVSQIGPDLSLPTVVATMLGSDESWKAMLDFCECTISQKEAAERERESSSLSAPIRRRRAGGRRRAFVRLRPL

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01421   Reprolysin
Interpro
IPR001878   Znf_CCHC        + More
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
1WDU     E-value=2.94486e-09,     Score=154

Ontologies

Topology

Length:
1741
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.06153
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00006
outside
1  -  1741
 
 

Population Genetic Test Statistics

Pi
12.945894
Theta
14.11249
Tajima's D
0
CLR
0.171598
CSRT
0.374231288435578
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号