SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11929
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.075 Nuclear   Reliability : 1.765
 

Sequence

CDS
ATGTACTACCCCAGGAGGGTACCTCCCGCTCCGCGGGGGAGAATCCCTCCGTGCGGTCGAGCGATCGGCCGCACGCTGCCCCACCGTTTCTGGGGGGGCAAACACTGCCACGAGGAAGGGGGCGACAGCACGGGTCGCGTAAGGGACAGAGTCCCCACCGTGCGCCTTGAGCGCTGCGAGAGCCTGATCTCGCTGTACTCGGCGCGGAGCTCCGCAAGGGGCGATGCGTCTAGTGGGCGGGAGACGCCAGCGCTGTTTGCCGATTGCGTTCGGCAGCGGACTCGGCGGAAGCGGAAGTCGGCTCGTCGGCCGGCGTCCTCCGCTCCGTCCGACTCCTCGGAGGGTGAGCCCGCCAGCGCCAAATATATGGCGATGGCGGAAGGGCCGGCGGCTGCTGCGGCGCCGCCTGCCACCAATTGTGACATTTCTTCCCGCGTACTGGACGCTGCCTCCTCGGCGCAGTCTAGGGCCGCCTGCCGCAAGGCAAAGAACGGGACAGAGGTAGGAGAGGTCGAGCGTCTGGAGCGCTCCCTGACGGAGGTGGGTCCCTATGACCCCCTCCGTAGATTGAACATTATCCAGAAACTTGTGTCTGCGGTGGCGACGAAGTCGAGCGCGGGCTTAAAGGGTGATTACCTACGGGCCCTCAAATCCTCAGCCGCCTCGATGGAGGAGATATTGGTGGAGGTGGTGGAGCGCACGACTGATAAGGAGAACGCGGACCTGCGGCGAGAGCTGGACCTGATGCACGCCCGCTTTGCGCAGGTTAGCGAAGAGAACGGCCACCTGCGAGCTGAAAACGGCCAAATCAAGGTCGATATGGCAGAGCTGCGCACGGTGGTCAACGACCTGGTAGAGAAGCAGCGCAGCTCGGCCCCCGTTCCCCCTCCGCCCGAAGTGGAAGATGAAAGCGAGGCCGAAGAGCTGAGGCGGCAACTCTTAATCTCGGAGGCACGCAGCTCCAAGGTGGAGCGTGCGAGACCGCCCCTCGCTCACGAGGCGAAAGGCGCTGCCCCCACACCGGCACCCCGAAAGAAAATGGCCGCAAAAACATATGGCGGTCCCAAAAAGGATGCGACACCAGCGGCACGTTCGGCCGCTTCAGCTGCTGCTCCGGCCAAACCCGGATCATCGGCAAAGGATACGGGGGCACCAAAACCCGCCCCCTCAAGGGCACCTATCACCGGCCAGCCCAAGACCCAGAAGGCCGCTCCTGCCCCGTCCCAGCCTGCGAAGGTGGGGCCCGGCAGGAGCCGGAATAAAAAGAAGGGGGGCGTCAACGCCGCCAAACCGGCACCGACTCCCCAGCCCCGCCCTCTGCCCCCGGCCCCAGCAAATATGGATGAGGCCTGGACGACGGTAGTGCGGCGTGGGCCTAAGAAAGTAGCGGTGCCTCCTGCGCCGCGTCCCAAGCCCGCCCCTGCGGCCACCGCTCCCCGCCAAGAGGGTCGAGCGGAGCCGAGGGGCCGAAATGGACGAAGGAGGCCGCGCGCCCCGCGGTCGGCTGCAGTGGTAGTGGAGCTGCTGCCGGCCGGCAAAGAAAAGGGCATCACCTACCACGAGACGGCCAACGGGGCCCGTCTCATAGAGTGCCCCGGCCCGAACACCAACGCCGCGGCCGAAAAATTGGCGGCCCGGCTGAGGGAGATTCTGCCGGACCCCGAGGTGGTGCGCATCGCGCGGCCCGTGAAGATGGGAGAAGTCAAAATCACGGGCCTCGACGAGTGCGCAACTAAGGAGGAGGTCGCCGCGGCCATCGCGTCGCAGGGCAACTGCGCCCTCGCCGACGTCAAAGTCGGAGAGCTCCGGGTGACATATTCCGGAACCCGGACGGCGTGGGCGCGTTGCCCGATTGCAACGGCGACCCTCCTGGCCACCCCTCCACAGGGGCGGCCTTCCGACAGCCCAGGAAGGCTGCGCGTGGGCTGGGTAGTGGCTCACGTGCAGCTGCAGGATGCCAGGCCGTGGCGCTGTCTTCGGTGCTTCGGCACCGGCCACGGTCTCGCCAAGTGCCCCTCGACCGTGGACCGCAGCGGCTTGTGTTTCCGCTGCGGCCAACCGGGGCACAAGGCAGCCTCCTGCACCACAGCCGCGCCGCACTGCGTCTTGTGCGACGCGGCCAAAAGGAAGGCCGACCACCGGGCCGGGGGCCCGGCGTGTAAATCCGCCCCCTCCTCTACAAAAACGAGGAGGGGCGGAAAGAAAAAGAAGCCGGCTGCAAAAAGAGCAGCCGGTGAGTCAGCTCCCGCCGCGGCACCAGAGCAGCCGCAAGGCGGGACAGACGAGGGAGCGATGGATGATCTCCTCGTCCACACCATGGCGGAGTGGTCAATCGACGTCGCTGTCGCCGCGGAGCCGTACTTCGTCCCCACCGACCAGGACTGCTGGATGGGGGACGTCGACGGCTCCGTGGCCATTGTGTTGAGACAGTCCGCGGCGTTACCCCCCTTGGAAATGGTGGCCAGGGGACCCGGGTACGTCGCGGCTAGGATCGACGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGAGCCTCGCCGAGTTCGAGCGGTTTCTGGGCGGGCTCGAGGCGCTTTTACACCGCCTCGGGTCCCGCCCTGTCATCGTCGCGGGGGACTTCAATGCCAAGTGCACGGCTTGGGGTTCCCCCCGCACGGATGCGAGAGGCGAGGCCCTTTCGGAGTGGGCGATCGCGACCGGCCTCTGTCTCCTAAACAGAGGCACGGTCGCGACTTGCGTGCGGTGGAACGGGCAATCTCACGTGGACGTGACGTTCGCGTCCCCGTCCGCCGTGCGCCGCACCCGCGGCTGGCGCGTACTCGAGGGGGCGGAGACGCTCTCGGACCACAGATACGTCCGATTCGAGCTCTCCGCCTCCTCCTTGTCGTCGTCGTCAGCCGCGGGCGCCCGCGGTGAGGAGGAGCTCCCGCAAGGTGCGCCCCGTTCGTTCCCCAGGTGGGCCTTGAAACGAATGAACAAGGAGTTGCTGATGGAGGCGGCCGCTGTTGCTGCGTGGGCGCCAAAACCCGCGCGGCTCGCGGACGTGGATGCGGAGGTCGACTGGTTCCGGGGCACCATGGCAAACATTTGTGATGCCGCCATGCCCCGGGTCGGCCCCCGAGCACCACGTGGGGGTGCGTTCTGGTGGTCGCCCGAGATCGCGAGACTCCGTGAGGAGTGCGTGAGGGCGCGCCGCCGGAGCGCACGCCACTGCCGCCGCCGTCGTCGCGACGCTACGTTCGCGGAGACGGCGGCCCGGCTGCACGCTGACTGTCGTCAAAAGCAGACGGCGCTGCAGCTGGCCATCGGCGAGGCCAAGAAGCAGAGCATGAAGACTCTCCTGGAGTCGCTCGACGAAGATCCCTGGGGGCGCCCATACAAGATGGTTCGCAGGAAACTGCAACCGTGGGCGCTCCCGGTGACCGAGCGGCTCCAGCCTCGGCAGCTGCGGGAAATTGTTGCGGCACTCTTCCCGCCGGCAGCGGGGGGGGACTTTGAGCCTCCCCAGATGGACGCCACGTGGGGCACGCCTCCGCGTCGCCCCAGCGTTCCCGCTGCCGAGGAGCCCCCTCCCCCTATCACGGGGGCGGAGATCCATGCGGCCGTGTCCAGAATGAGAGCGAAGGACGCGGCCCCCGGCCCTGACGGCGTTCACGGCCGGGTCTGGAGCTTGGCCTTCGAGGCCCTAGGGGACCGGCTCGGGGGGCTTTTCGAAGCGTGCCTCGAGTCGGGACGGTTCCCGTCGAAATGGAAGACGGGCAGACTGGTCCTTCTGCGGAAGGACGGGCGCCCTGCGGACTCACCCGCGGGCTATCGCCCCATCGTGTTGCTGGACGAAGCGGGCAAGATGCTCGAGAGAATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTCGGCGGAGCAATACGGCTTCAGAGAGGGCCGCTCGACTATCGACGCAATTCTGCGCGTGCGGGCCCTCTCCGATGAAGCCGTATCCCGGGGCGGGGTGGCGATGGCGTTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCTTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCCGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATTCGGGGACCCCTCCCCGGGCTCAGCGTAATTTGTTACGCTGACGACACGTTGGTCGTAGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACCAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGCTCTTTCACGGGCCGGGACGAGCGCCGCCTGTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTCGAACTGGACGGTCGGTGGAACTTCCGCGCTCACTTTGAGAAGTTGGGCCCTCGGCTGATGGCAACGGCCGGCTCTTTGAGCCGGCTCCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCGCCCGTATGGTGCCACGCCCTGACCCGCCAGAACGTCGCGGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAAGGCGCCCCGGCGAAGGAGTAGTTCGAGCGCGGAGGCTCCAATCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGTACCGTCGAGGCGGTCCGTCCGGTCCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTGACGCAGATGTTGACCGGCCATGGGTGTTTTGGCCGGTACCTCTTTAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATATCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGAGGGTACCTCCCGCTCCGCGGGGGAGAATCCCTCCGTGCGGTCGAGCGATCGGCCGCACGCTGCCCCACCGTTTCTGGGGGGGGCAAACACTGCCACGAGGAAGGGGGCGACAGCACGGGTCGCGTAAGGGACAGAGTCCCCACCGTGCGCCTTGAGCGCTGCGAGAGCCTGATCTCGCTGTACTCGGCGCGGAGCTCCGCAAGGGGCGATGCGTCTAGTGGGCGGGAGACGCCAGCGCTGTTTGCCGATTGCGTTCGGCAGCGGACTCGGCGGAAGCGGAAGTCGGCTCGTCGGCCGGCGTCCTCCGCTCCGTCCGACTCCTCGGAGGGTGAGCCCGCCAGCGCCAAATATATGGCGATGGCGGAAGGGCCGGCGGCTGCTGCGGCGCCGCCTGCCACCAATTGTGACATTTCTTCCCGCGTACTGGACGCTGCCTCCTCGGCGCAGTCTAGGGCCGCCTGCCGCAAGGCAAAGAACGGGACAGAGGTAGGAGAGGTCGAGCGTCTGGAGCGCTCCCTGACGGAGGTGGGTCCCTATGACCCCCTCCGTAGATTGAACATTATCCAGAAACTTGTGTCTGCGGTGGCGACGAAGTCGAGCGCGGGCTTAAAGGGTGATTACCTACGGGCCCTCAAATCCTCAGCCGCCTCGATGGAGGAGATATTGGTGGAGGTGGTGGAGCGCACGACTGATAAGGAGAACGCGGACCTGCGGCGAGAGCTGGACCTGATGCACGCCCGCTTTGCGCAGGTTAGCGAAGAGAACGGCCACCTGCGAGCTGAAAACGGCCAAATCAAGGTCGATATGGCAGAGCTGCGCACGGTGGTCAACGACCTGGTAGAGAAGCAGCGCAGCTCGGCCCCCGTTCCCCCTCCGCCCGAAGTGGAAGATGAAAGCGAGGCCGAAGAGCTGAGGCGGCAACTCTTAATCTCGGAGGCACGCAGCTCCAAGGTGGAGCGTGCGAGACCGCCCCTCGCTCACGAGGCGAAAGGCGCTGCCCCCACACCGGCACCCCGAAAGAAAATGGCCGCAAAAACATATGGCGGTCCCAAAAAGGATGCGACACCAGCGGCACGTTCGGCCGCTTCAGCTGCTGCTCCGGCCAAACCCGGATCATCGGCAAAGGATACGGGGGCACCAAAACCCGCCCCCTCAAGGGCACCTATCACCGGCCAGCCCAAGACCCAGAAGGCCGCTCCTGCCCCGTCCCAGCCTGCGAAGGTGGGGCCCGGCAGGAGCCGGAATAAAAAGAAGGGGGGCGTCAACGCCGCCAAACCGGCACCGACTCCCCAGCCCCGCCCTCTGCCCCCGGCCCCAGCAAATATGGATGAGGCCTGGACGACGGTAGTGCGGCGTGGGCCTAAGAAAGTAGCGGTGCCTCCTGCGCCGCGTCCCAAGCCCGCCCCTGCGGCCACCGCTCCCCGCCAAGAGGGTCGAGCGGAGCCGAGGGGCCGAAATGGACGAAGGAGGCCGCGCGCCCCGCGGTCGGCTGCAGTGGTAGTGGAGCTGCTGCCGGCCGGCAAAGAAAAGGGCATCACCTACCACGAGGTGATGACCCAGGCGCGCGGCGGCGTGAATGTGGACGCCCTCGGCGTGGAGGGGGGCATCAAGGTCCGGCAGACGGCCAACGGGGCCCGTCTCATAGAGTGCCCCGGCCCGAACACCAACGCCGCGGCCGAAAAATTGGCGGCCCGGCTGAGGGAGATTCTGCCGGACCCCGAGGTGGTGCGCATCGCGCGGCCCGTGAAGATGGGAGAAGTCAAAATCACGGGCCTCGACGAGTGCGCAACTAAGGAGGAGGTCGCCGCGGCCATCGCGTCGCAGGGCAACTGCGCCCTCGCCGACGTCAAAGTCGGAGAGCTCCGGGTGACATATTCCGGAACCCGGACGGCGTGGGCGCGTTGCCCGATTGCAACGGCGACCCTCCTGGCCACCCCTCCACAGGGGCGGCCTTCCGACAGCCCAGGAAGGCTGCGCGTGGGCTGGGTAGTGGCTCACGTGCAGCTGCAGGATGCCAGGCCGTGGCGCTGTCTTCGGTGCTTCGGCACCGGCCACGGTCTCGCCAAGTGCCCCTCGACCGTGGACCGCAGCGGCTTGTGTTTCCGCTGCGGCCAACCGGGGCACAAGGCAGCCTCCTGCACCACAGCCGCGCCGCACTGCGTCTTGTGCGACGCGGCCAAAAGGAAGGCCGACCACCGGGCCGGGGGCCCGGCGTGTAAATCCGCCCCCTCCTCTACAAAAACGAGGAGGGGCGGAAAGAAAAAGAAGCCGGCTGCAAAAAGAGCAGCCGGTGAGTCAGCTCCCGCCGCGGCACCAGAGCAGCCGCAAGGCGGGACAGACGAGGGAGCGATGGATGATCTCCTCGTCCACACCATGGCGGAGTGGTCAATCGACGTCGCTGTCGCCGCGGAGCCGTACTTCGTCCCCACCGACCAGGACTGCTGGATGGGGGACGTCGACGGCTCCGTGGCCATTGTGTTGAGACAGTCCGCGGCGTTACCCCCCTTGGAAATGGTGGCCAGGGGACCCGGGTACGTCGCGGCTAGGATCGACGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGAGCCTCGCCGAGTTCGAGCGGTTTCTGGGCGGGCTCGAGGCGCTTTTACACCGCCTCGGGTCCCGCCCTGTCATCGTCGCGGGGGACTTCAATGCCAAGTGCACGGCTTGGGGTTCCCCCCGCACGGATGCGAGAGGCGAGGCCCTTTCGGAGTGGGCGATCGCGACCGGCCTCTGTCTCCTAAACAGAGGCACGGTCGCGACTTGCGTGCGGTGGAACGGGCAATCTCACGTGGACGTGACGTTCGCGTCCCCGTCCGCCGTGCGCCGCACCCGCGGCTGGCGCGTACTCGAGGGGGCGGAGACGCTCTCGGACCACAGATACGTCCGATTCGAGCTCTCCGCCTCCTCCTTGTCGTCGTCGTCAGCCGCGGGCGCCCGCGGTGAGGAGGAGCTCCCGCAAGGTGCGCCCCGTTCGTTCCCCAGGTGGGCCTTGAAACGAATGAACAAGGAGTTGCTGATGGAGGCGGCCGCTGTTGCTGCGTGGGCGCCAAAACCCGCGCGGCTCGCGGACGTGGATGCGGAGGTCGACTGGTTCCGGGGCACCATGGCAAACATTTGTGATGCCGCCATGCCCCGGGTCGGCCCCCGAGCACCACGTGGGGGTGCGTTCTGGTGGTCGCCCGAGATCGCGAGACTCCGTGAGGAGTGCGTGAGGGCGCGCCGCCGGAGCGCACGCCACTGCCGCCGCCGTCGTCGCGACGCTACGTTCGCGGAGACGGCGGCCCGGCTGCACGCTGACTGTCGTCAAAAGCAGACGGCGCTGCAGCTGGCCATCGGCGAGGCCAAGAAGCAGAGCATGAAGACTCTCCTGGAGTCGCTCGACGAAGATCCCTGGGGGCGCCCATACAAGATGGTTCGCAGGAAACTGCAACCGTGGGCGCTCCCGATGGACGCCACGTGGGGCACGCCTCCGCGTCGCCCCAGCGTTCCCGCTGCCGAGGAGCCCCCTCCCCCTATCACGGGGGCGGAGATCCATGCGGCCGTGTCCAGAATGAGAGCGAAGGACGCGGCCCCCGGCCCTGACGGCGTTCACGGCCGGGTCTGGAGCTTGGCCTTCGAGGCCCTAGGGGACCGGCTCGGGGGGCTTTTCGAAGCGTGCCTCGAGTCGGGACGGTTCCCGTCGAAATGGAAGACGGGCAGACTGGTCCTTCTGCGGAAGGACGGGCGCCCTGCGGACTCACCCGCGGGCTATCGCCCCATCGTGTTGCTGGACGAAGCGGGCAAGATGCTCGAGAGAATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTCGGCGGAGCAATACGGCTTCAGAGAGGGCCGCTCGACTATCGACGCAATTCTGCGCGTGCGGGCCCTCTCCGATGAAGCCGTATCCCGGGGCGGGGTGGCGATGGCGTTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCTTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCCGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATTCGGGGACCCCTCCCCGGGCTCAGCGTAATTTGTTACGCTGACGACACGTTGGTCGTAGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACCAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGCTCTTTCACGGGCCGGGACGAGCGCCGCCTGTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTCGAACTGGACGGTCGGTGGAACTTCCGCGCTCACTTTGAGAAGTTGGGCCCTCGGCTGATGGCAACGGCCGGCTCTTTGACCCGGCTCCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCGCCCGTATGGTGCCACGCCCTGACCCGCCAGAACGTCGCGGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGGGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAAGGCGCCCCGGCGAAGGAGTAGTTCGAGCGCGGAGGCTCCAATCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGTACCGTCGAGGCGGTCCGTCCGGTCCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTGACGCAGATGTTGACCGGCCATGGGTGTTTTGGCCGGTACCTCTTTAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATATCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCAAGGGGGCGACAGCACGGGTCGCGTAAGGGACAGGGTCCCCACCGTGCGCCTCGAGCGCTGCGAGAGCCTTATCTCGCTCTACTCGGCGCGGAGCTCCGCGAGGGGCGACGCGTCCAGTGGGCGGGAGACACCGGCGCTGTTCACCGACACGCGACAGCGGACTCGGCGGAAGCGGAAGTCGGCCCGACAGCCGGCATCCTCTGCTCCGTCTGACTCGTCCGAGGGTGAGCCTGCCAGCGCCAAATATATGGCGTTGGCGGAAGGGCCGGCGACTGCTGCGGCGTCGCCCGCCACCGGCTTCGAAAAAAGTTCCTCTTGCGGACTGGACGCTGCCTCCTCGGCGCAGTCCCGGGAAAAATTTGAGATTGGAGTGGTTCAGCGCCTAGAGCGCTCCCTAACGGAGGTGGGTCCCTCTGACCCCCTCCGAGCTTTCGAGGTGGTCGGAAAATTAGTTTCCGCAGTCGTGGCAACATCCGGCGGTGGACTCAAGGGTGACTGCGTGCGGGCCTTAAAATCCGGAGCGGCCACCCTAGAAGAACGTCTGAGGGAAGTGGTAGACCGCACCACAACGACGGAGACGGCGGGCTTGCGGCAGGAAGTGGCCCTGCAGCACGCCCGCCTCGAGCAACTCTCGAACGAGAATGGCAAACTTCGGGCGGAGAATGGGCAGCTGCGAGTGGACATGGCCGAGTTGAGGACCATGGTTGCCGACCTCATCGAGCGGCAACGCAGCTCGGCCCCTGCCCCTCCTCCGCCCGAAGCGGAAGGCCTCAGTGAGGTGGACGAGTTGAGGCGGCAGCTCCTCATACAGGAGGCGCGCAGCTCCAAAGTGGAGCGCGCGAGACCGCCCCTCGCTCACGAGGCTAACGGAAGTACGCCTGTGCCGGCACCCCGCAGGAGTGTGCAGCCCGCTGTAAAAGCATACAGCGGGAAGAAGAAGGCTACACCCGCGCGAGCTCCCGCTGCGGCTGCACCTAAACCCGCGGCTGTAGGGGCGCCGGCACCCACGGCCCCTGCATCAAAACCGGTGTCCGCTCCTGCCCCGTCCAAGCCTGCGAAGGCGGGGCCTGGCAGGAGCCGAAACAAAAAGAAGGGGCGGACCAACGCCGCCAAACCGGCACCGACCCCCCAGCCCCGCCCACTGCCCCCAGCCCCGGCCAACATGGACGAGGCCTGGACGACGGTGGTGCGGCGCGGGCCCAAAAAGGTTGCGGCGCCTGTCGTGCCACGCCCCAAGCCCGCCCCTACGGCCGCCGCTCCCCGTCAAGAGGGTCGAGCGGAGCCTAGGGGCCGAACTGGACGAAGGAGGCCGCGCGCCCCGCGGTCGGCTGCAGTAGTCGTGGAGCTGCTGCCGGCCGCCAAAGAACGGGGCATCACGTACCACGACGTGATGACTCAGGCGCGCGGCGGCGTAAATGTGGACGCCCTCGGCGTGGAGGGTGGCCTTAAGGTTCGGCAGACGGCCAACGGGGCCCGCCTGGTAGAATGCCCCGGCGCGAATTCCAGCGCCGCGGCAGAAAAACTGGCGGTCCGTCTGCGGGAAATCTTGCCGGACCCCGAGGTGGTGCGCATCGCGCGGCCCGTAAAGATGGCGGAGGTGAAGATTACGGGCCTCGACGAGTGCGCCACGAAAGAGGAGGTCGCCGCGGCCATCGCGTCGCAGGGCAACTGCGCCCTCGCCGACGTCAAAGTCGGGGAGCTCCGGGCGACGTACTCCGGAACCCGGACGACGTGGGCGCGTTGCCCGGTAGCAACGGCGAACCTCCTGGCCACCCCTCCACAGGGTCGGCCTTCGGACAGCCCAGGATGGCTGCGCGTGGGCTGGGTAGTGGCCCACGTGCAACTGCAGGAGAGCAGGCCGTGGCGTTGTCTTCGGTGCTTCGGCACCGGCCACGGCCTCGCCAAGTGCCCCTCGACAGTGGACCGCAGCGACCTGTGCTTCCGCTGCGGCCAACCGGGGCACAAGGCAGCCTCCTGCACCGCAGCCGCGCCGCACTGTGTCTTGTGCGACGCGGCTAAAAGGAAGGCCGACCACCGGGCCGGGGGCCCGGCGTGCAAGTCCGCCCCCTCCTCTACAAAAACGAGGAGGGGCGGAAAGAAAAAGAAGCCGGCTGCAAAAAGGGCAGCCGGTGAGTCAGTTCCCGCCGCGGCACCAGAAGAGCCGCAGGGCGGGACAGACGAGGGAGCGATGGACGATCTCCTCGTCCACACCATGGCGGAGTGGTCAATCGATGTTGCTGTCGCCGCGGAGCCGTATTTCGTCCCCACTGACCAGGACTGCTGGATCGGGGACGTCGACGGCTCCGTGGCCATTATATTACGACAGTCCGCGGCGTTACCCCCCTTGGATATGGTGGCCAGGGGACCCGGGTACGTTGCGGCTAGGATCGACGGGACCGTCGTGATCGGGGCGTACTTTTCTCCGAACAGGAGCCTCGCCGAATTCGAACGGTTTCTGGGCGGGCTCGAGGCGCTTTTACACCGCCTCGGGTCCCGCCCTGTCATCGTCGCGGGGGACTTCAATGCCAAGTGCACGGCTTGGGGTTCCCCCCGCATGGATGCGCGAGGCGAGGCCCTTTCGGAGTGGGCGATCGCGACCAGCCTCTTTCTCATAAACAGAGGTTCGGTCGCGACTTGCGTGCGGTGGAACGGGCAGTCTCATGTGGACGTGACGTTCGCGTCCCCGTCCGTCGCATGCCGAACCCGCGGCTGGCGCGTACTCGAGGGGGCGGAGACGCTCTCGGACCACAGATACGTCCGATTCGAGCTCTCCGCCTCCTCCTTGTCGTCGTCGTCAGCCGCGGGCGCCCGCGGCGAGGAGGAGCTCCCGCAAGGTGCGCCCCGTTCGTTCCCCAGGTGGGCCTTGAAACGGATGAACAAGGAGTTGCTGATGGAGGCGGCCGCTGTTGCTGCGTGGGCGCCAAAACCCGCGCGGCTCGCGGACGTGGATGCGGAGGTCGACTGGTTCCGGGGCACCATGGCAAACATTTGTGATGCCGCCATGCCCCGGGTCGGCCCCCGAGCACCACGTGGGGGTGCGTTCTGGTGGTCGCCCGAGATCGCGAGACTCCGTGAGGAGTGCGTGAGGGCGCGCCGCCGGAGCGCACGCCACCGCCGCCGCCGTCGTCACGACGCTGCGTTCGCGGAGACGGCGGCCCAGCTGCACGCTGACTGTCGTCAAAAGCAGACGGCGCTGCAGCTGGCCATCGGCGAGGCCAAGAAGCAGAGCATGAAGACTCTCCTGGAGTCGCTCGACGAAGATCCCTGGGGGCGCCCATACAAGATGGTTCGCAGGAAACTGCAGCCGTGGGCGCTCCCGGTGACCGAGCGGCTCCAGCCTCGGCAGCTGCGGGAGATAGTTTCCGCGCTTTTCCCGCCGGCAGCGGGGGGGGACTTTGAGCCCCCCCAGATGGACGCCACGTGGGGCACACCTCCACGTCGCCCCAGCGTTCCCGCTGCCGAGGAGCCCCCTCACCCTATCACGGGGGCGGAGATCCATGCGGCCGTGTCCAAAATGAGAGCGAAGGACACGGCCCCCGGCCCTGACGGCGTTCACGGCCGGGTCTGGAGCTTGGCCTTCGAGGCCCTAGGGGACCGGCTCGGGGGGCTTTTCGAAGCGTGCCTCGAGTCGGGACGGTTCCCGTCGAAATGGAAGACGGGCAGACTGGTCCTTCTGCGGAAGGACGGGCGCCCCGCGGACTCACCCGCGGGCTATCGCCCCATCGTGTTGCTGGACGAAGCGGGCAAGATGCTCGAGAGGATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTCGGCGGAGCAATACGGCTTCAGAGAGGGCCGCTCGACTATCGACGCAATTCTGCGCGTGCGGGCCCTCTCCGACGAAGCCGTATCCCGGGGCGGGGTGGCGATGGCGCTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATTGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCCTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGACGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCTGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATTCGGGGTCCCCTCCCCGGGCTGAGCGTAATATGTTACGCCGACGACACGTTGGTCGTGGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACATGTCGTCACTAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGATAAAACCCAGGCCCTGCTTTTTCACGGGCCGGGACGAGCGCCGCCTGTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTTGGGGTGACCGGTCTTCGGTACCTCGGCCTCGAACTGGATAGTCGGTGGAACTTCCGCGCTCACTTTGAGAAGTTGGGCCCTCGACTGATGGCGACGGCCGGCTCTCTGAGCCGGCTGCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGGGCTCCCGTATGGTGCCGCGCCCTGACCCGCAAGAACGTCGCGGCTCTGCGACGTCCGCAGCGTGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACAGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAGGGCGCCCCGGCGAAGGTGTAGTTCGAGCGCGGAGGCTCCACTCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGAACCGTCGAGGCGGTCCGCCCGGTTCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTAACGCAGATGCTTACCGGCCATGGTTGTTTCGGCCGGTACTTGCACAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGTGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATAGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGAGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MYYPRRVPPAPRGRIPPCGRAIGRTLPHRFWGGKHCHEEGGDSTGRVRDRVPTVRLERCESLISLYSARSSARGDASSGRETPALFADCVRQRTRRKRKSARRPASSAPSDSSEGEPASAKYMAMAEGPAAAAAPPATNCDISSRVLDAASSAQSRAACRKAKNGTEVGEVERLERSLTEVGPYDPLRRLNIIQKLVSAVATKSSAGLKGDYLRALKSSAASMEEILVEVVERTTDKENADLRRELDLMHARFAQVSEENGHLRAENGQIKVDMAELRTVVNDLVEKQRSSAPVPPPPEVEDESEAEELRRQLLISEARSSKVERARPPLAHEAKGAAPTPAPRKKMAAKTYGGPKKDATPAARSAASAAAPAKPGSSAKDTGAPKPAPSRAPITGQPKTQKAAPAPSQPAKVGPGRSRNKKKGGVNAAKPAPTPQPRPLPPAPANMDEAWTTVVRRGPKKVAVPPAPRPKPAPAATAPRQEGRAEPRGRNGRRRPRAPRSAAVVVELLPAGKEKGITYHETANGARLIECPGPNTNAAAEKLAARLREILPDPEVVRIARPVKMGEVKITGLDECATKEEVAAAIASQGNCALADVKVGELRVTYSGTRTAWARCPIATATLLATPPQGRPSDSPGRLRVGWVVAHVQLQDARPWRCLRCFGTGHGLAKCPSTVDRSGLCFRCGQPGHKAASCTTAAPHCVLCDAAKRKADHRAGGPACKSAPSSTKTRRGGKKKKPAAKRAAGESAPAAAPEQPQGGTDEGAMDDLLVHTMAEWSIDVAVAAEPYFVPTDQDCWMGDVDGSVAIVLRQSAALPPLEMVARGPGYVAARIDGTVVIGAYFSPNRSLAEFERFLGGLEALLHRLGSRPVIVAGDFNAKCTAWGSPRTDARGEALSEWAIATGLCLLNRGTVATCVRWNGQSHVDVTFASPSAVRRTRGWRVLEGAETLSDHRYVRFELSASSLSSSSAAGARGEEELPQGAPRSFPRWALKRMNKELLMEAAAVAAWAPKPARLADVDAEVDWFRGTMANICDAAMPRVGPRAPRGGAFWWSPEIARLREECVRARRRSARHCRRRRRDATFAETAARLHADCRQKQTALQLAIGEAKKQSMKTLLESLDEDPWGRPYKMVRRKLQPWALPVTERLQPRQLREIVAALFPPAAGGDFEPPQMDATWGTPPRRPSVPAAEEPPPPITGAEIHAAVSRMRAKDAAPGPDGVHGRVWSLAFEALGDRLGGLFEACLESGRFPSKWKTGRLVLLRKDGRPADSPAGYRPIVLLDEAGKMLERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGAMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPVGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFEKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRQNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGERRPGEGVVRARRLQSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLFKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARGYLPLRGGESLRAVERSAARCPTVSGGGKHCHEEGGDSTGRVRDRVPTVRLERCESLISLYSARSSARGDASSGRETPALFADCVRQRTRRKRKSARRPASSAPSDSSEGEPASAKYMAMAEGPAAAAAPPATNCDISSRVLDAASSAQSRAACRKAKNGTEVGEVERLERSLTEVGPYDPLRRLNIIQKLVSAVATKSSAGLKGDYLRALKSSAASMEEILVEVVERTTDKENADLRRELDLMHARFAQVSEENGHLRAENGQIKVDMAELRTVVNDLVEKQRSSAPVPPPPEVEDESEAEELRRQLLISEARSSKVERARPPLAHEAKGAAPTPAPRKKMAAKTYGGPKKDATPAARSAASAAAPAKPGSSAKDTGAPKPAPSRAPITGQPKTQKAAPAPSQPAKVGPGRSRNKKKGGVNAAKPAPTPQPRPLPPAPANMDEAWTTVVRRGPKKVAVPPAPRPKPAPAATAPRQEGRAEPRGRNGRRRPRAPRSAAVVVELLPAGKEKGITYHEVMTQARGGVNVDALGVEGGIKVRQTANGARLIECPGPNTNAAAEKLAARLREILPDPEVVRIARPVKMGEVKITGLDECATKEEVAAAIASQGNCALADVKVGELRVTYSGTRTAWARCPIATATLLATPPQGRPSDSPGRLRVGWVVAHVQLQDARPWRCLRCFGTGHGLAKCPSTVDRSGLCFRCGQPGHKAASCTTAAPHCVLCDAAKRKADHRAGGPACKSAPSSTKTRRGGKKKKPAAKRAAGESAPAAAPEQPQGGTDEGAMDDLLVHTMAEWSIDVAVAAEPYFVPTDQDCWMGDVDGSVAIVLRQSAALPPLEMVARGPGYVAARIDGTVVIGAYFSPNRSLAEFERFLGGLEALLHRLGSRPVIVAGDFNAKCTAWGSPRTDARGEALSEWAIATGLCLLNRGTVATCVRWNGQSHVDVTFASPSAVRRTRGWRVLEGAETLSDHRYVRFELSASSLSSSSAAGARGEEELPQGAPRSFPRWALKRMNKELLMEAAAVAAWAPKPARLADVDAEVDWFRGTMANICDAAMPRVGPRAPRGGAFWWSPEIARLREECVRARRRSARHCRRRRRDATFAETAARLHADCRQKQTALQLAIGEAKKQSMKTLLESLDEDPWGRPYKMVRRKLQPWALPMDATWGTPPRRPSVPAAEEPPPPITGAEIHAAVSRMRAKDAAPGPDGVHGRVWSLAFEALGDRLGGLFEACLESGRFPSKWKTGRLVLLRKDGRPADSPAGYRPIVLLDEAGKMLERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGAMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPVGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFEKLGPRLMATAGSLTRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRQNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAGALAADYRWRSDLRSRGERRPGEGVVRARRLQSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLFKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYAQGGDSTGRVRDRVPTVRLERCESLISLYSARSSARGDASSGRETPALFTDTRQRTRRKRKSARQPASSAPSDSSEGEPASAKYMALAEGPATAAASPATGFEKSSSCGLDAASSAQSREKFEIGVVQRLERSLTEVGPSDPLRAFEVVGKLVSAVVATSGGGLKGDCVRALKSGAATLEERLREVVDRTTTTETAGLRQEVALQHARLEQLSNENGKLRAENGQLRVDMAELRTMVADLIERQRSSAPAPPPPEAEGLSEVDELRRQLLIQEARSSKVERARPPLAHEANGSTPVPAPRRSVQPAVKAYSGKKKATPARAPAAAAPKPAAVGAPAPTAPASKPVSAPAPSKPAKAGPGRSRNKKKGRTNAAKPAPTPQPRPLPPAPANMDEAWTTVVRRGPKKVAAPVVPRPKPAPTAAAPRQEGRAEPRGRTGRRRPRAPRSAAVVVELLPAAKERGITYHDVMTQARGGVNVDALGVEGGLKVRQTANGARLVECPGANSSAAAEKLAVRLREILPDPEVVRIARPVKMAEVKITGLDECATKEEVAAAIASQGNCALADVKVGELRATYSGTRTTWARCPVATANLLATPPQGRPSDSPGWLRVGWVVAHVQLQESRPWRCLRCFGTGHGLAKCPSTVDRSDLCFRCGQPGHKAASCTAAAPHCVLCDAAKRKADHRAGGPACKSAPSSTKTRRGGKKKKPAAKRAAGESVPAAAPEEPQGGTDEGAMDDLLVHTMAEWSIDVAVAAEPYFVPTDQDCWIGDVDGSVAIILRQSAALPPLDMVARGPGYVAARIDGTVVIGAYFSPNRSLAEFERFLGGLEALLHRLGSRPVIVAGDFNAKCTAWGSPRMDARGEALSEWAIATSLFLINRGSVATCVRWNGQSHVDVTFASPSVACRTRGWRVLEGAETLSDHRYVRFELSASSLSSSSAAGARGEEELPQGAPRSFPRWALKRMNKELLMEAAAVAAWAPKPARLADVDAEVDWFRGTMANICDAAMPRVGPRAPRGGAFWWSPEIARLREECVRARRRSARHRRRRRHDAAFAETAAQLHADCRQKQTALQLAIGEAKKQSMKTLLESLDEDPWGRPYKMVRRKLQPWALPVTERLQPRQLREIVSALFPPAAGGDFEPPQMDATWGTPPRRPSVPAAEEPPHPITGAEIHAAVSKMRAKDTAPGPDGVHGRVWSLAFEALGDRLGGLFEACLESGRFPSKWKTGRLVLLRKDGRPADSPAGYRPIVLLDEAGKMLERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGTMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPVGAHLVIGGVRVGVGVTGLRYLGLELDSRWNFRAHFEKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCRALTRKNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPGEGVVRARRLHSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLHKIAGREPTAQCHHCADRDEEDTVEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=1.90018e-09,     Score=160

Ontologies

Topology

Length:
5431
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.22722
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  5431
 
 

Population Genetic Test Statistics

Pi
14.055576
Theta
19.132768
Tajima's D
0
CLR
15.461271
CSRT
0.373681315934203
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号