SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11920  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA013473
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.495
 

Sequence

CDS
ATGCTCAGACTTAATGAGCTGGAAGCGGAGCTGGCGACAAAGATTAGCACCTTTCGGGGCTATGCCTGGCAGGAGAGGATCGAAGAGGCCCGCGAGGACCCCTCCTCAGTATCCCTCCACCGGCTTTGTCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATATCCTGGCCGAAATGCTGGAGCGGCAGTTCGCTCCTAATGACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCAAGCCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGGTGATCTCATCACTCCCAGCGAATTGCGCCTCATCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGCGAGGACGGTATTCCCTCCCTCGCTTTTTTCCACTTCCCTGAAACGGTCGTGTCATATATGACACGGCTGTTCAACTCCATTCTGTCCACAGGACACTTCCCGGGAATTTGGAAATTGGGCAAGGTTATCGCCTTGCCCAAACCCGGCAAGGACAGGAGAAATCCCTCCAGTTACCGTCCGATCACGCTGCTGTCGCACGTGGGCAAGTTGTTCGAGCGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCTCAGACCCGAGCAATTCGGGTTTCGTAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTTATGCATCACTTGGCGGATCGGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGACATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCCACAAGCTGTTGCAGAACACGGACCTCCAGCACGCCTACGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCCAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCGCAGGGGAGCGTCCTGGCACCGTTCCTCTACGCTCTCTATACCAACGATATTCCCACGCTCGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCGCGTCATCCAACTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGTTATTGGACTTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACTGCGGCTATTCTCTTCGGTCCAGTCCGCACAACAGTCGTCCCGGGACAGCTCAGTCTCCGTGGCGCTAATGTCGAGTTTAGATCCAGCGTCCGGACTAAGCTCGGCATTTATAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGGGTATGCGGGAGAGGTTACAGGTCCAGCAAAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATTCGGAGGCTAGCTCGTAATATGTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTAGGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGCTCAGAAGCGAGCGAGTCACCGTATCAGACAGAACGCTCCTGCGTAATATACGCTCTGAGTTAACATTTCTGGTTTTATTGACTTATGAAGACCACCCGCTTACCATGTCGCTACCCGAAAGTGGAAATACTCCAACATCAGAAGAGGGAACACCACGTGACGAACAACGGCCTAATGACGTAATTCAAGCTATGGCAGACGCATTTAAAACCACGATGAACGATATGATGACTCAACTGTCTTACGATCATCGCGTAACCTTGACTGCAATGATCGGCACCATGAAATCAGAAGAAAATACGCGAGTGCGCATTGCCGACGTTTATTTTCCTACATATGACCCCGATTCTAGTACCGATGTACATGATTGGGTAGATCTTATTACACGTACTCAAGCAGAATATGGACTTCGAGATCATGAGGTACGATTAAAAGCAGCAAGTGTATTAAAAGGTCGTGCAAAGACATGGGCAGATAGTAGCCTCCTAAGGACAACAACCTGGACGGAAATGCGGGATGACATGTTGCAAACTTTCGAACCCGAATCCAGGTACTTTGCAGATATTCTGAGTTATAGAAATTACACCATTGACGAGGCAGAAAACATTCAAGATTTTATTTCAAACGTGTGGCGTATGTTCAAAAGGATAGTAAAACCTCATCCAACGGAACAGGATGCAGTAGAATTTGTCATTGGGAGCATTGGAGATGAACGGATTCGGACAGAACTGCTCAATAGCAAGTCAAATACTGTTCCGGAGTTAATTGCTATAGCCAAAACGTTTCGCAAACGAAAGAATATACCAACTAAACCGACTGAGTTCAGTAAGCAACCTCGTTTGAACTTTAATCGTGATAGATCCAACTTAACTTGTCATGTTTGTGGAAAAACAGGTCATTTTGCTGGATATTGCCCGGAAAATGCAATTCGACGTGGAACGTTTTCAGCATCAGGATCAGGAGCTTCTTTCTCATCAAGAGATTCGCCTGTACCATCCATTAAGGAGTGTTCCTACTGTAAAGGGACTCGACACACTACAGAAAGATGTTTTAAAAGAATTGCTGACGAACAACACAGAACGAAATGGATATGGACTGCCTCTCACGAAGCAACAAGATTAAACATAATCGATTACCGTACCTGCGCGCTGCTTCATACCATGTTCAAAGAGGGCGTACCAATTGAACTTCATACAGATGCAAGTGATGCTGATCCAACTATCACTCATATGAATTGGAGACTGTGGCTGTTAGACGAAGTTTTGTGCCAAAAAGTTAAGCTGAAGAATGGAAGAACCAAGACTCTAAAAGCGGTACCACAATACTACCAATGGAGTATCATAAATAATTACCACAAAGTTTTAAAACACTTTGGCTGGGAGAAAGCACTCGAAAAACTCAAAGAACACTTTTGGTCTGACAAATTGAGCTCAAAAGTTCGCAGCTTCATAGACAATTGCGTGTACGGCATTGAACTGCACCACATCGTAGCATACACGAATAGATCAAACGGCCAGGCCAAAAGAATTTTCCGCATCGTTAAAGATGGACTCACTGTCATTAGACTAATGCCGCAGAGACGCGTCAATTGCAGAATGGCCGTGTCGGCGCGCGGCTTAGATCACAAAGCGCATCCGCACCCTGCGTCAGCGAGCGCCGCCGGCACACCTGCAACAGTCGACGGCAGGCGGCTTGGATCACAGAGGGCAATCGCTTCGGCCAATTTAGTGTTACCGACGCAGGGGCCTCGCCGCAAGGCGAGCGCGTGTTTAAGTCCCGGGGCCGCCCCCCCGGGCGAAAATCACGTAAAGATGGAGGAAAAACTTTTCATCGACTTCATTCGGGAAAAATATCCGTCAATCGCGCCCGAATTCGAAGCCTATAGGGCCTCATTTAGTAAATATTCTCCCCCCGCATCTCTCGCCGCCGTCGCCAAACATGCCTCGCAGGCATGCCTCGCGTGCCCCGCCGCCGGTCCGTGTTCAAGCGCACGTACGCACGCCGCCGCCGTAGCGTCTAACGCCCCCGCCCCCGCTACCCCCGCGCCCGCGTCAATCACGTCAGTTTCGTCCGTCGCGACCTCAATAGCGTCTAGTTCAGGCTCCGATACCGAATCGGAGATGGACTTCGAGTCCGCGACTAGCCCTCAACCCGGAACCTCGGATGGGTTCCAAACTGTAACGCGCGGTAAAAAGCGTACTCGCATCGTGGAGTCCCGGAGCTCCATGACGAAGCAAACCAAGTCCGCGACCGCCTCCCGACCGCAGGTAGTCGTAACGCCGGAGTCGGACTCCGCCCGCCGCGTAATCCCACCGCCGCGCCCAAAAACCGCGCCCGCGCCTAAAACAGTTGTCCCGCCCCCGCTGATACTCCAGGAGAAGTCAGCGTGGAATCGCGTATCCCAGGCCCTTCAGGCCAACAAAATTAATTATACCCATGCGCGTAACGTCGCGCATGGGATTCAGATTAAGGTCGCAACGCCGGGCGACCATAGGGCCCTCTCTGCTTACCTCCGAAAGGAGAACATAGGTTATCACACCTATGCTCTTCAGGAGGACCGCGAACTCCGCGTAGTGATACGTGGAGTCCCCAAGGAACTCGACATAGACTACGTAAAGGAGGATCTGATCGGTCAGTCCCTCCCAATAATTAGTGTGCACCGGATGCACAGCGGACGCGGCAGACAGCCGTACAATATGATTCTCGTCGCGCTAGAATCAACCCCGGAGGCAAAGAAAAGAATCTCATGTCTCAAAACGATATGCGGCCTCTCCGGGGTCACCATCGAAGCCCCCCATAAACGTGGTACTCCCGGGCAGTGCCACAGGTGCCAGCTCTATGGCCACTCAGCGCGTAATTGCCACGCGCGCCCCCGCTGCGTGAAATGCCTCGGCGATCACGCAACCACAGAATGTTCGCGTGTTAGGGAAACCGCGACGGAACCCCCAAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCGGCAAACTACCGCGGATGTCCTAGGGCTCCGCGTAAACGCCCGAACCACCCAGCCCCCCGAACCGTCGACCCAAAGACTTCGGCGCCTTCAGTGCCGAAACCAGCCTTCGTACCGGCTGCGGTTCCCACCGTCTCGGCGTGGAAAAAACCGCTGCCGTATACGAAGGAGGGAACACAAAACGTACCCCAGCTCCCGCCTGCGACACGTCACGCGCCTCAGCCCCTGCTCGCACCTCGCCCCGCGCCCGCATACCGCCCCCCGCAACCCTCAGTCGTCAACGACTTCGCGCTCGTGCGCGACTTCGTCACCGCGGTAAACTTTGACCGTCTGCGATCGTTCGCAGATGCTATCCCATTCTACAATGCTAACGGACTCGCGCGGCAACGCGATCAAATTTTCGAATTCCTCCGCGACAATCTTGTAGATATTTTGTTAGTGCAGGAGACCTGTCTGAAGCCCTCGCGTCGTGACCCGAAAGTCGCGAATTACGTCATGGTTAGAAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCGGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTCCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCCGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACGAACGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACTTTTGAAGTAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTTAGGAACGTAACTCTGCGCTTACGTTCCATCGAAGCACTGTCAGAGCTCGACTCAGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCTCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGTTGGGCACGTGCCTAGCCGAAGCCGCTCCGCCAATCCTCCCTTACGGCCCGGATTCGAATCTATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATCTCTTCCGCGATCATTAGATCTTCAAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTATCCTCCGAACTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGGCTTCCCACGCATTCAAACCGGATTCGGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCCTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCGTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCTGACGCGTTACCCCCCATTACCACTGACGAAGTTAGAGACGCGATCCACAATCTCCAACCTAGGAAGGCACCCGGCTCCGACGGCATCCGCAACCGCGCGCTAAAACTCTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGACAAACGAAACATCTAGTTACCGTCCGATTAGTCTCCTCCCGACGATAGGAAAAATTTACGAACGGCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCTAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATCCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGATATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACTGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGAATTGACATCAACCCCACGAAAAGCGCAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACATCACTTCGAGCATCCCACTCCGTAGTAGGCGCGCAAACACCTCCACCGTTAGTCCCATCACTCTCTTTGGCCAGCCCATACCGTGGGTCTCGAAGGTCAAATATCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATAAAAACGGTACGCGACCGCGCCGCGTTTATTCTAGGACGACTCTATCCAATGCTTTGTTGTCGAAGCAAGCTGTCCCTCCGTAATAAGGTAACTCTCTACAAAACTTGTATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACGCAGCCCGCACCAACTTGAAATCCCTTCAGGTTATTCAATCAAAATTCTGCAGGATAGCCGTCGGAGCGCCATGGTTCCTTAGGAATGTGGATCTCCACGATGACCTGGAGCTCGACTCATTTAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTCGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGGTAAACCGTCGACGTCGCCCAAAGCACGTCATTACGGATCCTCCTGATCCATTAACGGTGCTCTTAGGCACCACAAGCACCGGTCACCGTCCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGCGAACTAA
Protein
MLRLNELEAELATKISTFRGYAWQERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADILAEMLERQFAPNDSAPSEAAFHQSVEESVASLLSSPVPPLGDGDLITPSELRLIIKRMKRRKAPGEDGIPSLAFFHFPETVVSYMTRLFNSILSTGHFPGIWKLGKVIALPKPGKDRRNPSSYRPITLLSHVGKLFERLLLRRVSPHILLRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYTAAVFLDIEKAFDRVWHAGLIHKLLQNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPFLYALYTNDIPTLEGNLQAWEADVKLALFADDSAYFASSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTTVVPGQLSLRGANVEFRSSVRTKLGIYKTYVRSRITYAAAAWYHLIPQGMRERLQVQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNMYERADGGPHEHLHNIAPLHARPPDGRALPRELLEPPAMLRSERVTVSDRTLLRNIRSELTFLVLLTYEDHPLTMSLPESGNTPTSEEGTPRDEQRPNDVIQAMADAFKTTMNDMMTQLSYDHRVTLTAMIGTMKSEENTRVRIADVYFPTYDPDSSTDVHDWVDLITRTQAEYGLRDHEVRLKAASVLKGRAKTWADSSLLRTTTWTEMRDDMLQTFEPESRYFADILSYRNYTIDEAENIQDFISNVWRMFKRIVKPHPTEQDAVEFVIGSIGDERIRTELLNSKSNTVPELIAIAKTFRKRKNIPTKPTEFSKQPRLNFNRDRSNLTCHVCGKTGHFAGYCPENAIRRGTFSASGSGASFSSRDSPVPSIKECSYCKGTRHTTERCFKRIADEQHRTKWIWTASHEATRLNIIDYRTCALLHTMFKEGVPIELHTDASDADPTITHMNWRLWLLDEVLCQKVKLKNGRTKTLKAVPQYYQWSIINNYHKVLKHFGWEKALEKLKEHFWSDKLSSKVRSFIDNCVYGIELHHIVAYTNRSNGQAKRIFRIVKDGLTVIRLMPQRRVNCRMAVSARGLDHKAHPHPASASAAGTPATVDGRRLGSQRAIASANLVLPTQGPRRKASACLSPGAAPPGENHVKMEEKLFIDFIREKYPSIAPEFEAYRASFSKYSPPASLAAVAKHASQACLACPAAGPCSSARTHAAAVASNAPAPATPAPASITSVSSVATSIASSSGSDTESEMDFESATSPQPGTSDGFQTVTRGKKRTRIVESRSSMTKQTKSATASRPQVVVTPESDSARRVIPPPRPKTAPAPKTVVPPPLILQEKSAWNRVSQALQANKINYTHARNVAHGIQIKVATPGDHRALSAYLRKENIGYHTYALQEDRELRVVIRGVPKELDIDYVKEDLIGQSLPIISVHRMHSGRGRQPYNMILVALESTPEAKKRISCLKTICGLSGVTIEAPHKRGTPGQCHRCQLYGHSARNCHARPRCVKCLGDHATTECSRVRETATEPPSCVLCLKQGHPANYRGCPRAPRKRPNHPAPRTVDPKTSAPSVPKPAFVPAAVPTVSAWKKPLPYTKEGTQNVPQLPPATRHAPQPLLAPRPAPAYRPPQPSVVNDFALVRDFVTAVNFDRLRSFADAIPFYNANGLARQRDQIFEFLRDNLVDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLLHIEASVCRISLTGHRPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEVVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEALSELDSDHRPVVMQLGRPHNPVTVTRTMVDWNKLGTCLAEAAPPILPYGPDSNLSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSSELRNLLRVRNAAIRAYDRLPTHSNRIRMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIRNRALKLLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPTNETSSYRPISLLPTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATMGQWFRKWRIDINPTKSAAVLFKRGRPPNITSSIPLRSRRANTSTVSPITLFGQPIPWVSKVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCCRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKSLQVIQSKFCRIAVGAPWFLRNVDLHDDLELDSFSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMVNRRRRPKHVITDPPDPLTVLLGTTSTGHRPRRTRRLRRRARRAN

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.000218756,     Score=113

Ontologies

Topology

Length:
2603
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.596549999999998
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00052
outside
1  -  2603
 
 

Population Genetic Test Statistics

Pi
429.131063
Theta
207.278136
Tajima's D
3.475945
CLR
1.564339
CSRT
0.994150292485376
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号