SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11907
Pre Gene Modal
BGIBMGA013783
Annotation
AF461149_1_transposase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.57
 

Sequence

CDS
ATGGCGTCATTACAAGAAAGTCAAATGGCAGCATTCGAACGCCTACTCGACCGAGTTTTTGAGCATAAAACTCAACTCGAATCATCAGCAACACCGACGTCGGAGCCGACATCACCGCCTTCCTCGACGCCCGCTCACCATTCTGGGAACTTCGCGTCATGCACGGCGCGGTTCAGCGGAGCGCCCGGCGACTCACTCGACGGTTTCCTTGACGCGGTCGAATCATACAAAGATTGTGCTGACGTAGGACACGCCATCGCGTTACGAGGACTCTCGATGTTACTAAACGGAAATGCAGCCATGTGGTGGCAAGGCGTTAAAGCTAGCATCACTTCCTGGGACGACGCTTTATCATCGTTACGAAGCGCTTTCGGTGATTGCAGACCGCCCCATCGAGTCTACTTAGAGCTCTTCAAAATGTCGCAAGGACAAAGAGAGAAGACGGAGATCTTCGTTGCAAGAGCACGAGCCCTGCTAGCTCGACTCCCACCTGGTGACCTTAGTGAGAAAGTTCAAATTGATATGCTTTACGGCCTTCTACACCGTCGTGTTCGTAAAAGATTAAGAAGAGACGAAATAACTTCATACGACACGTTATTAAAGAAAACGCGCCATATCGAGGACTCCATCTACGAGACCAGTCCGCCTGAATTTATTCATCATCCTCAGCGAGCGACGCCACATGCTCAAAATAATGAAACTTTGCTTGGCATGGATTTTTTGGTGGCGGCAGGTATTGTGCTTGACTTTGCTTCATCCACTTGGCATTTTTCGGGAAAACGGGTTACCTATCCAATTGAATATGAGTGCCCTAAACCATGCATGTTTGCTTCTACTGCTGACTTCCTGCGTGATGATAAGGGTTCTATGCTTGGCTCCGATGAACGGCAGCAGCTATCACATTTATTGCAGGAGAATGGAGACATCTTTAGGGTGGGGGGAGCCCCAACCCTTTACGCCGAGCACCACATTGATACCGGTGATCATCCGCCTATATCGGTACCGCCGTATAGGCTCACTCCTGTGCTTCAACAGCGAGGAGAGGTTCTCGCAATCGATTTGTTCGGGCCACTGCCAGAAGCAGAGCAGGGGGAGCGATGGGTACTCCTGGTAGAGGATGTAGCTACAAGATGGGTAGAACTCTACGCACTTGTTGATGCCACCGCCGTGGCTTGCTCCCGAGTCCTACTGGAAGAGCCCACTCGGATAGAAGCTCTACTGAGGTCACTGGGTATTGTACTGAAGTCCTCCAAGGTCTCTGTCATAATTACAACATCGTTGGCGAACCAAAGATTCGTTTATCATACCATCAAACGATACAATGAAGACTCTAGTGTAGATGACAAGTCAAGAAGTGGTCGCCCTCGGTCTGTTAGGACTCCAGCAGTGATAAAAGCTGTGAAGGCACGAATTCAAAGAAATCCCAAACGTAAGCAGAAACTGTTGGCCCTTCAGATGGGGTTAAGCAGAACCACGGTGAAAAGGGTGTTAAATGAAACCTTAGGGCTTCGGGCATATCGAAGAAAAATAGGACATCGTTTGAATGCTCGTCTAATGGACCTGAGACTGAAGAGATGCCGCGCTTTGTTGAAGCGGTACGCGGGAAAAAAATATCGGGAAATTCTTTTTTCGGATGAAAAAAATTTTACCGTAGAAGAGAGCTACAACAAACAAAATGATAAGGTGTACGCACACAGTAGTGAAGAAGCGAGCAACCGTATTCCGCGTGTCCAACGAGGTCATTTTCCATCCTCGCTCATGGTATGGTTGGGAGTTTCTTATTGGGGCTTAACAGAGGTACATTTTTGTGAGAAAGGTGTAAAAACGAATGCAGTTGTGTATCAAAATACAGTCCTGACGAACCTTGTGGAACCTGTTTCTCATACCATGTTCAATAACAGGCACTGGGTATTCCAACAAGATTCGGCGCCAGCTCATAGAGCGAAGAGCACACAAGACTGGCTGGCGGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCAGATTTGAATCCGTTAGATTACAAGATATGGCAACACTTGGAGGAAAAGGCGTGCTCAAAGCCTCATCCCAATTTGGAGTCACTCAAGACATCCTTGATTAAGGCAGCCGCCGATATTGACATGGACCTCGTTCTGCTGCGATAG
Protein
MASLQESQMAAFERLLDRVFEHKTQLESSATPTSEPTSPPSSTPAHHSGNFASCTARFSGAPGDSLDGFLDAVESYKDCADVGHAIALRGLSMLLNGNAAMWWQGVKASITSWDDALSSLRSAFGDCRPPHRVYLELFKMSQGQREKTEIFVARARALLARLPPGDLSEKVQIDMLYGLLHRRVRKRLRRDEITSYDTLLKKTRHIEDSIYETSPPEFIHHPQRATPHAQNNETLLGMDFLVAAGIVLDFASSTWHFSGKRVTYPIEYECPKPCMFASTADFLRDDKGSMLGSDERQQLSHLLQENGDIFRVGGAPTLYAEHHIDTGDHPPISVPPYRLTPVLQQRGEVLAIDLFGPLPEAEQGERWVLLVEDVATRWVELYALVDATAVACSRVLLEEPTRIEALLRSLGIVLKSSKVSVIITTSLANQRFVYHTIKRYNEDSSVDDKSRSGRPRSVRTPAVIKAVKARIQRNPKRKQKLLALQMGLSRTTVKRVLNETLGLRAYRRKIGHRLNARLMDLRLKRCRALLKRYAGKKYREILFSDEKNFTVEESYNKQNDKVYAHSSEEASNRIPRVQRGHFPSSLMVWLGVSYWGLTEVHFCEKGVKTNAVVYQNTVLTNLVEPVSHTMFNNRHWVFQQDSAPAHRAKSTQDWLAAREIDFIRHEDWPSSSPDLNPLDYKIWQHLEEKACSKPHPNLESLKTSLIKAAADIDMDLVLLR

Summary

Uniprot
ProteinModelPortal
PDB
5CR4     E-value=7.83746e-10,     Score=155

Ontologies

Topology

Length:
720
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.13343
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00435
outside
1  -  720
 
 

Population Genetic Test Statistics

Pi
259.108763
Theta
179.046081
Tajima's D
1.001199
CLR
0.351938
CSRT
0.653417329133543
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号