SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11878
Annotation
ORF2_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.841 Mitochondrial   Reliability : 1.272
 

Sequence

CDS
ATGAGTGGTGTCCGGGGCGTAAGGGTCTTCCAGAATACCAGGATCGAGGAGGGCACTGTAAAAGCGGCAATAGCCGTCTTTGACGCTAATATTAGCGTTATACAGTACCCAGAACTCACCACCAATAACATCGTGGTGGTGGGGATTCGTACTGGTACCTGGGAAATCACGCTGGCATCGCTCTACTTCGAGCCGGACAAGCCTATAGAACCCTTTCTCGACCACCTAAGGAAGGTAGGAAAAGCCACCAACATCATCATCGGTGGCGATGTCAATGCCAGGAGTGTCTGGTGGGGAGGACCATCGACCAACAGCAGGGGCGAAGCGTTGCTGGGGGCCCTCGACGAGCTCGGTCTCCATGTCCTCAACCAAGGCGAAATTCCCACATTCGACGTAATCCGAGGGGAGCGACACCTGACGAGCTATGTCGATATCACGGCATGCTCACCGGATGTACTCGGCCTGGTGGACGATTGGCGAGTGCTGGAAGACCTGACGAGTTCCGACCATAATGGTATAGAGTTCAAAATTAATTTACACAAGTCCAAAGGACATACAGTACACAGAACCACACGCATATACAACACGAAAAAGGCAAATTGGGCCCAGTTTCGTGTGAAACTGGGCGAATTACTGCTGAGCACTACACTGAACAGGGACGCAATAAATAATATTAACACTATACAGGAAATTGAACAAATCACAGTAACATACACTAACACTATTACAAACGCCTGTACACACACAATACCACAAAAGAAAAATTTGGAGAAATTTTCTGTGCCATGGTGGTCGGAGGAGCTCGCCGGGTTGAAACGGCGTGTTGTCACCAGAAAGAGGAGGATCCGATGTGCCGCACTGGCCCGGAGGCCGAGGGTGGTGCAAGAGTACCTGGAGGAACGGGCAAAATACCGGGCTGCGATAAAAGAGGCCCAGATCGCAAGCTGGAAGGGGTTCTGCGAGAGGCAGGACCGCGAAGGCATGTGGGAGGGGATTTATCGGGTGATAGGCAGGGTTTCGAGACGGGAGGAAGACATACCCATGGAGCGGGAAGGGATAGTGCTGGACGCGGATAGTTCAGCCACGTACTTGGCTGAAACGTTTTATCCGGAGGACCTTACCGATTTGGACGATCCCGGGCATGGCGAGACGAGGAGGCGAGCCGCTGAACTAGATAGCGACAGTGGCGGCGCTCGAGACCCCCCGTTCACCATGCACGAGCTCGACAGATCGGTGAGGTCCTTCAACCCCAAGAAGGCTCCAGGCGCCGATGGATTGACCGCCGACATTTGTAAGGAAGCGGTCAACAGTGATCCCGAGCTGTTCCTGGCGCTCGTAAACAAGTGCCTCGAGCTGCGTTACTTCCCGAAGGTGTGGAAGGCGGCCACGGTCATCATACTCAGAAAACCTGGCAAGAACAACTACGCCACCCCCAAAGCGCACAGACCGATTGGCCTTTTGCCTGTGCTGGGGAAGGTATATGAGAAGATGATAGTGGCACGTCTAAAGTACCATATTTTGCCGAGCATGAGCGCTCACCAATATGGCTTTATGCCACAGAGGAGCACCGAAGACGCCCTATATACCCTGTTGGAACGCATTAGAGAAAAGCTTCTTGACAAGAAACTGATCCTAATGGTCTCGCTGGATATAGAGGGGGCCTTCGACAGCGCCTGGTGGCCGGCCATAAAGGTGAGGCTCGTCGAGGAGTCGTGCCCGGTTGGTATACGGGGAGTAATGAATAGTTATATGAGCGACAGGACGGTTGGAGTCCGCTACATGGGCGCCGAACATCTGAGAGCCACGGGAAAAGGATGCGTCCAGGGCTCCATAGGAGGCCCTATCCTGTGGAACCTCTTGCTCGATCCTCTGCTTAAGGGACTCAGTACCAGAGGGGACTACGTCCAGGCGTTTGCTGACGACGTTGTCCTCCTCTTCGACGGGGATACAGCGATGGACGTTCAGAGACGTGCCAATGCCGCCCTCGAGTATGTTCGGGCGTGGGGTGTCATAAACAAGCTGAAATTCGCTCCGCACAAAACCTGTGCGATGGTAATCACGCGGAAGCTGAAGCATGACACCCCGCGCCTGAGCATGGGCGGGGTAGACATTGGCATGTCTAAGGAGGTACTGTTGTTAGGGCTCACCATCGACCATAAACTTACATTTAACACCCATGTTGCCAATGTTTGCGCTAAAGCCGCAAACCTATACAAAAGGCTAACCAGGGCAGCCAAAGTTGGCTGGGGTCTGCACCCCGAAGTTATCAAGACCATATACATCGCAGTGGTTGAACCCGTGATCCTGTATGCCTCGAGCGCGTGGGCGCCGGCCGCAAACAAACTGGGAGTGCGGAAGCGCCTCAACGCGGTCCAGCGTAGCTTCGCACAGAAGCTCTGTCGAGCCTACCGAACGGTATCCCTGAACTCAGCACTGGTGCTGGCAGGGGTGCTCCCCCTTGACCTACGCGTACGCGAGATGGCCTCGCTATACGTGGCCAAGAGGGGGGCGCATCTGCCGGTGCTGGGAGACAGGGATATCGAGCGGGTGGCATCGGCACTGGAGAGGCCTCATCCAGCGGAACAAGTTGGGATGGAGCTACGAAGCCTGGTAGACGAGGAGCAATACCTCGAACATCGAGGATATGAGGTGCGTATATTTACGGACGGGAGCAAGATTGAGGGCAAGGTCGGGGCCGCGCTATCCATCTGGACTGGCGAGGCCGAAGCCAAAACCCTCAAACTTGCTCTCTCGCCCCACTGTACCGTCTACCAGGCAGAGCTCTTGGCCCTTTGTGAAGCTGCAAATGAGATCAGCCGGCGAAAAGAGAACGTTTTCGCCATCTTCAGCGACTCCATGGCGGCCCTTCAGACAGTGGCTGACCCGGATTCCCTTCACGTCCTTGCGGTCCGGATGAGGGGCGCTCTTAGTCACTGCAAAACGCAGGGCAAGAGCGTCTCCTTGTTTTGGATTAAGGCTCACGCGGGACTTGAGGGGAATGAGAGGGCCGATGCCCTGGCTAAAGCGGCCGCCCTGAGGTTGAAGAAGAAACCCAACTATGACCGGTGTCCGGTCTCATTCGCGAAGCGTGTAATCCGCATGGACACGCTCGCCGAATGGGATCGGAGGTACAGCGCCGAACAAACGGCCTCAGTCACCAAGCTGTACTTCCCAATCGCGTCCGAGGCATACAGGATAATCAGAAAGATCGAAATGACCAAGGAGGTAGCACAGGCCTTCACAGGGCATGGTGGGTTCTCCGAGTACTTGGCCAGGTTCAAGTGCAAGGAGAGCCCAGCATGCATCTGTGACCCTTACGTCGACGAGTCAGTGGCCCACGTGCTTCTGGAGTGTCCAGTCTTTGGCTCAGCACGATTCGACTTGGAGGTCGAACTGGGCCAAAGACTCCATGCGCGAGAACTCCCCAATTTAATGAAAAAAACCTGTGCGAGGAACTTGTTCCTAAAATATGCTATAAAAATTATAAAGGAGGTTAATAAAAGAAATAGAACATAA
Protein
MSGVRGVRVFQNTRIEEGTVKAAIAVFDANISVIQYPELTTNNIVVVGIRTGTWEITLASLYFEPDKPIEPFLDHLRKVGKATNIIIGGDVNARSVWWGGPSTNSRGEALLGALDELGLHVLNQGEIPTFDVIRGERHLTSYVDITACSPDVLGLVDDWRVLEDLTSSDHNGIEFKINLHKSKGHTVHRTTRIYNTKKANWAQFRVKLGELLLSTTLNRDAINNINTIQEIEQITVTYTNTITNACTHTIPQKKNLEKFSVPWWSEELAGLKRRVVTRKRRIRCAALARRPRVVQEYLEERAKYRAAIKEAQIASWKGFCERQDREGMWEGIYRVIGRVSRREEDIPMEREGIVLDADSSATYLAETFYPEDLTDLDDPGHGETRRRAAELDSDSGGARDPPFTMHELDRSVRSFNPKKAPGADGLTADICKEAVNSDPELFLALVNKCLELRYFPKVWKAATVIILRKPGKNNYATPKAHRPIGLLPVLGKVYEKMIVARLKYHILPSMSAHQYGFMPQRSTEDALYTLLERIREKLLDKKLILMVSLDIEGAFDSAWWPAIKVRLVEESCPVGIRGVMNSYMSDRTVGVRYMGAEHLRATGKGCVQGSIGGPILWNLLLDPLLKGLSTRGDYVQAFADDVVLLFDGDTAMDVQRRANAALEYVRAWGVINKLKFAPHKTCAMVITRKLKHDTPRLSMGGVDIGMSKEVLLLGLTIDHKLTFNTHVANVCAKAANLYKRLTRAAKVGWGLHPEVIKTIYIAVVEPVILYASSAWAPAANKLGVRKRLNAVQRSFAQKLCRAYRTVSLNSALVLAGVLPLDLRVREMASLYVAKRGAHLPVLGDRDIERVASALERPHPAEQVGMELRSLVDEEQYLEHRGYEVRIFTDGSKIEGKVGAALSIWTGEAEAKTLKLALSPHCTVYQAELLALCEAANEISRRKENVFAIFSDSMAALQTVADPDSLHVLAVRMRGALSHCKTQGKSVSLFWIKAHAGLEGNERADALAKAAALRLKKKPNYDRCPVSFAKRVIRMDTLAEWDRRYSAEQTASVTKLYFPIASEAYRIIRKIEMTKEVAQAFTGHGGFSEYLARFKCKESPACICDPYVDESVAHVLLECPVFGSARFDLEVELGQRLHARELPNLMKKTCARNLFLKYAIKIIKEVNKRNRT

Summary

EMBL
D38414    BAA07467.1    AB046668    BAB21511.1    GFTR01008639    JAW07787.1    + More
GFAH01000444    JAV47945.1    GBBI01004920    JAC13792.1    KP771711    AKU04648.1    KK115320    KFM64783.1    KK114278    KFM62077.1    NCKU01007943    RWS02258.1    KP771712    AKU04650.1    KK119855    KFM76920.1    ABLF02014981    LBMM01003366    KMQ93606.1    GEDC01008950    JAS28348.1    GEDC01005462    JAS31836.1    GBBI01004973    JAC13739.1    GEFM01005915    JAP69881.1    GECZ01013919    JAS55850.1    ABLF02039177    GANO01003496    JAB56375.1    ABLF02012872    ABLF02012873    ABLF02012874    ABLF02012875    ABLF02042485    AAZX01008070    AAZX01006426    ABLF02019936    ABLF02057951    GEGO01004274    JAR91130.1    KU543680    AMS38365.1    ABLF02008516    ABLF02041501    ABLF02010037    ABLF02010039    ABLF02066755    GFTR01008452    JAW07974.1    AB182560    BAD82946.1    GANO01003539    JAB56332.1    GANO01003538    JAB56333.1    KU543676    AMS38357.1    GFTR01008431    JAW07995.1    GFTR01008645    JAW07781.1    GACK01003634    JAA61400.1    ABLF02006133    KU543675    AMS38355.1    GFTR01008469    JAW07957.1    ABLF02016436    M19755    AAC13649.1    ABLF02012458    ABLF02012459    GANO01003536    JAB56335.1    KK116791    KFM68755.1    ABLF02022279    GBGD01000371    JAC88518.1    RSAL01000474    RVE41603.1    GALA01001772    JAA93080.1    ABLF02003402    ABLF02025552    ABLF02031460    ABLF02044302    ABLF02059589    ABLF02065568    ABLF02066832    ABLF02066838    ABLF02011238    GFTR01008646    JAW07780.1    ABLF02004512    ABLF02004513    ABLF02046624    ABLF02049075    ABLF02059998    ABLF02065990    KU543678    AMS38361.1    ABLF02004774    ABLF02007045    KU543672    AMS38350.1    ABLF02010931    GANO01003141    JAB56730.1    GANO01003537    JAB56334.1    KU543677    AMS38359.1    ABLF02027069    ABLF02027071    ABLF02014982    KQ972380    EFA13507.2    GANO01003451    JAB56420.1   
Pfam
PF00075   RNase_H        + More
PF00078   RVT_1
PF14529   Exo_endo_phos_2
PF00004   AAA
PF17862   AAA_lid_3
PF16725   Nucleolin_bd
PF05225   HTH_psq
PF05585   DUF1758
PF03564   DUF1759
PF00059   Lectin_C
PF05485   THAP
PF00098   zf-CCHC
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR012337   RNaseH-like_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR002156   RNaseH_domain       
IPR003959   ATPase_AAA_core       
IPR027417   P-loop_NTPase       
IPR003960   ATPase_AAA_CS       
IPR031996   NVL2_nucleolin-bd       
IPR041569   AAA_lid_3       
IPR003593   AAA+_ATPase       
IPR038100   NLV2_N_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR007889   HTH_Psq       
IPR005312   DUF1759       
IPR008737   Peptidase_asp_put       
IPR016187   CTDL_fold       
IPR016186   C-type_lectin-like/link_sf       
IPR001304   C-type_lectin-like       
IPR006612   THAP_Znf       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
SSF52540   SSF52540       
SSF57756   SSF57756       
SSF56436   SSF56436       
PDB
1WDU     E-value=2.22645e-55,     Score=550

Ontologies

Topology

Length:
1171
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.50002
Exp number, first 60 AAs:
0.02009
Total prob of N-in:
0.00112
outside
1  -  1171
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号