SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11873
Pre Gene Modal
BGIBMGA012113
Annotation
PREDICTED:_uncharacterized_protein_LOC106720810_[Papilio_machaon]
Full name
ATP-dependent DNA helicase      
Location in the cell
Cytoplasmic   Reliability : 1.533 Mitochondrial   Reliability : 1.102 Nuclear   Reliability : 1.259
 

Sequence

CDS
ATGGGAGTGCAACTACACAATGATGTACAATCTGGACAATATGCTGCTGCTCTTCTTAAAATTGGAGAAGATCGTATGGCAAAGGATGGTAATGGCATGATTACATTGGATCGTGAATTCTGCAATGTTGTGCATAATCCAGATGATCTAAATAACTTCGTCTATAGCGAACTGCTAACTAATATGAGGAATAGAGACTGGTTATGTGAAAGAGCAATTTTAGCGCCGACGAATGAAATGGTGGGACAGATAAACGAGCAAATTATGTCACGCGTGGAAGGTGATATTGTTGAGTTTCTCTCTGTAGACACTGTAATGGATACTGAACAAGTAACATCATACCCTGTAGAATTTCTTAATTCTTTAGAACTGTCGGGAGTACCTTCACACAAACTGAGGCTGAAAGTAGGCGTTCCTGTCCTTTTAATGCGGAATTTAGATGCACCAAGACTGTGTAATGGCACACGGTTGCAAGTGACACACCTCGGTCGCAATATTGTAAAAGCAATCATTATGACTGGAATGGCAAAAGGAGAGAACGTTTTAATCCCCCGTATACCCATAATTCCGACAGATTTGCCATTCCAGTTTAAGAGATTACAGTTTCCGCTGAAAATCGCATTCGCTATGACGATAAATAAAGCTCAGGGGCAAACATTAAAAGTAGCCGGCATTAATTTAGAAAAGAGTTGTTTTTCTCACGGACAATTATACGTGGCTTGCTCACGTGTTTCAAGTCCACAGAATCTCCATGTGTTGGCCAGAGAGGGAAAAACAAAGAACATAGTTTACAAAAATGTACTACAGTAA
Protein
MGVQLHNDVQSGQYAAALLKIGEDRMAKDGNGMITLDREFCNVVHNPDDLNNFVYSELLTNMRNRDWLCERAILAPTNEMVGQINEQIMSRVEGDIVEFLSVDTVMDTEQVTSYPVEFLNSLELSGVPSHKLRLKVGVPVLLMRNLDAPRLCNGTRLQVTHLGRNIVKAIIMTGMAKGENVLIPRIPIIPTDLPFQFKRLQFPLKIAFAMTINKAQGQTLKVAGINLEKSCFSHGQLYVACSRVSSPQNLHVLAREGKTKNIVYKNVLQ

Summary

Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Cofactor
Mg(2+)
Similarity
Belongs to the helicase family.
Feature
chain  ATP-dependent DNA helicase
EC Number
3.6.4.12
EMBL
BABH01016327    BABH01021294    BABH01021295    RSAL01000260    RVE43353.1    KE125416    + More
EPB68564.1    KN773623    KIH45171.1    KN768221    KIH46987.1    GECZ01022632    JAS47137.1    KN726977    KIH66756.1    KN726652    KIH67553.1    JOJR01000352    RCN39175.1    KN727000    KIH66715.1    KN739487    KIH54222.1    GAKP01015355    JAC43597.1    KN747262    KIH51216.1    KN730120    KIH61447.1    ABLF02006664    GGMR01007248    MBY19867.1    JOJR01000395    RCN38503.1    JARK01000714    EYC35207.1    KN743176    KIH52626.1    KE126587    EPB66060.1    GGMR01003219    MBY15838.1    ABLF02004758    ABLF02010540    KN739098    KIH54434.1    KN768033    KIH47189.1    ABLF02030014    GAIX01013838    JAA78722.1    LC056060    BAW33744.1    KN739955    KIH53984.1    HQ009558    AEE09607.1    GECZ01026766    JAS43003.1    GAKP01009346    JAC49606.1    ABLF02011512    ABLF02065998    KQ417009    KOF94238.1    ABLF02041349    ABLF02027436    KQ415755    KOG00729.1    ABLF02016601    ABLF02024213    ABLF02041347    NIVC01001359    PAA68995.1    GECU01024866    GECU01018275    GECU01015236    JAS82840.1    JAS89431.1    JAS92470.1    KQ419659    KOF82676.1    GEDC01024516    GEDC01006142    JAS12782.1    JAS31156.1    KN730017    KIH61566.1    NIVC01000111    PAA90396.1    NIVC01001486    PAA67379.1    KQ419625    KOF82809.1    NIVC01000366    PAA84583.1    NIVC01000229    PAA87485.1    RSAL01000338    RVE42429.1    NIVC01001445    PAA67902.1    KQ422072    KOF75554.1    RSAL01001639    RVE40746.1    ABLF02042290    BABH01039432    JOJR01000539    RCN36628.1    KQ425876    KOF68891.1    LBMM01007929    KMQ89299.1    NKXS01013118    PIM96964.1    UYRW01004572    VDM92857.1    KN736527    KIH55917.1    ABLF02024220    ABLF02041348    ABLF02039419    ABLF02041372    ABLF02063377    GEDC01007314    JAS29984.1    ABLF02033400    ABLF02023575    NEVH01005285    PNF38967.1    ABLF02016932    ABLF02041819    ABLF02021501    ABLF02028709    ABLF02028715    ABLF02048760    ABLF02055417    ABLF02055419    ABLF02059664    ABLF02003694    GGFJ01008921    MBW58062.1    ABLF02006222    JOJR01002614    RCN28445.1    ABLF02021131    ABLF02042289    KN775179    KIH44846.1    APGK01055334    KB741262    KB631831    ENN71556.1    ERL86591.1    ABLF02035713    ABLF02026638    JOJR01001936    RCN29467.1    KE125929    EPB66767.1    KQ417234    KOF93074.1    GFWV01012558    MAA37287.1    GBXI01006514    JAD07778.1    ABLF02033384    ABLF02035040    ABLF02018175    ABLF02041816    ABLF02047719   
Pfam
PF05970   PIF1        + More
PF10262   Rdx
PF14214   Helitron_like_N
PF02689   Herpes_Helicase
Interpro
IPR010285   DNA_helicase_pif1-like        + More
IPR027417   P-loop_NTPase       
IPR011893   Selenoprotein_Rdx-typ       
IPR036249   Thioredoxin-like_sf       
IPR025476   Helitron_helicase-like       
IPR003840   DNA_helicase       
IPR038765   Papain-like_cys_pep_sf       
IPR003653   Peptidase_C48_C       
SUPFAM
SSF52540   SSF52540        + More
SSF52833   SSF52833       
SSF54001   SSF54001       
PDB
6HPU     E-value=2.92534e-11,     Score=163

Ontologies

Topology

Length:
269
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00878999999999998
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04373
outside
1  -  269
 
 

Population Genetic Test Statistics

Pi
132.38966
Theta
72.272262
Tajima's D
1.766595
CLR
0.060981
CSRT
0.839458027098645
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号