SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11869
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.65 Nuclear   Reliability : 1.532
 

Sequence

CDS
ATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAATCCGAGATGCTAGGTGGTCTGATTTCTTAGAAGGACTCGCGCCCTCTCAAAGGTCTTACTACCGTTTAGCTCGTACTCTCAAATCGGATACGGTTGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGTCGACTCGCGGCGTTTGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCATTCAATCCGCGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCAATGGAAGTTAAAGACCTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCATCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCAGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGTTACCGCCCGATTAGCCTCCTCATGTCTCTGGGCAAACTGTATGAGCGTTTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCAAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTGCAAATCACTCATGCGTACAACAGGTGCACCGCCTCACGGAGCACATTCTTGTAGGACTTAACCGACCAAAACCGATCTATACGGGAGCCCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTTTTCAACATGGGCGTACCGGATAGTCTCGTGCTCATCATACGAGACTTCTTGTCTAACCGCTCTTTTCGATATCGAGTAGAGGGAACCCGCTCCTCCCCGCGACCACTCACGGCTGGAGTCCCGCAAGGCTCCGTTCTCTCTCCGCTCCTATTTAGTTTATTTATTAACGATATTCCCCGGTCGCCGCCGACTCAGCTAGCCTTATTCGCTGACGACACAACCGTTTACTACTCAAGTAGAAACAAGTCCCTAATCGCGAGTAAGCTCCAGAGTGCAGCGTTAACCCTCGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGCACAGCAGTGTTATTTCAAAGGGGAAACTCACCGCTTATTTCCTCCCGCATTAGGAGGAGAAATATCACACCCCCGATCACCCTCTTCGGCCAACCTATACCCTGGGCTAGGAAGGTCAAGTACCTGGGAGTCACCCTGGATGCATCCATGACATTCCGCCCGCATATAAAAACAGTCCGCGATCGTGCCGCATTTATTCTCGGCAGACTCTATCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGGGCTCCGTGGTTCGTGAGGAACGTCGACCTACACGACGACCTGGGCCTCGAATCGATCCGCAAACACATGAAGTCAGTGTCGGAACGTTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCTGCCGCTGACTACTCCCGAATCCTGATCACGCAGGAGCAAGTCACCGTCGTCGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAA
Protein
MRALQRDVKSRIAEIRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSIQSADPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPIQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRANHSCVQQVHRLTEHILVGLNRPKPIYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFINDIPRSPPTQLALFADDTTVYYSSRNKSLIASKLQSAALTLGQWFRKWRIDINPAKSTAVLFQRGNSPLISSRIRRRNITPPITLFGQPIPWARKVKYLGVTLDASMTFRPHIKTVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKHMKSVSERYFDKAMRHDNRLIVAAADYSRILITQEQVTVVALDTSLRIHQIQ

Summary

EMBL
AB018558    BAA76304.1    AB055391    BAB21761.1    U07847    AAA17752.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    KQ459259    KPJ02068.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    GALX01005359    JAB63107.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    GGMR01019198    MBY31817.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02042518    ABLF02057746    ABLF02014862    ABLF02014866    ABLF02061908    ABLF02003961    ABLF02059872    GBBI01004395    JAC14317.1    RPOV01000134    RPJ78669.1    ABLF02008933    GFTR01008038    JAW08388.1    KK117880    KFM71667.1    GFXV01007093    MBW18898.1    NEVH01000269    PNF43694.1    S59870    AAB26437.2    ABLF02033757    GBBI01001646    JAC17066.1    NEVH01017542    PNF24034.1    NEVH01006736    PNF36716.1    GGMS01006359    MBY75562.1    GGMS01000737    MBY69940.1    ABLF02021177    ABLF02027367    ABLF02066338    GGMS01002955    MBY72158.1    NEVH01020940    PNF20481.1    GBYB01008290    JAG78057.1    GGMS01017914    MBY87117.1    ABLF02008463    NEVH01020071    PNF21969.1    ABLF02034467    GBBI01004571    JAC14141.1    NEVH01010546    PNF32261.1    GGMS01008766    MBY77969.1    NEVH01023962    PNF17612.1    NEVH01007443    PNF35684.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01022639    PNF18527.1    NEVH01003017    PNF40781.1    NEVH01018383    PNF23463.1    NEVH01006721    PNF37225.1    GGMR01000676    MBY13295.1    NEVH01005938    PNF38077.1    NEVH01001355    PNF42855.1    GGMS01012005    MBY81208.1    GEZM01038405    JAV81653.1    GEZM01053022    JAV74219.1    GGFJ01002256    MBW51397.1    NEVH01002704    PNF41489.1    NEVH01026386    PNF14434.1    NEVH01007838    PNF34986.1    GGFJ01002257    MBW51398.1    NEVH01014858    PNF27387.1    NEVH01002716    PNF41415.1    NEVH01000280    PNF43672.1    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    NEVH01019964    PNF22161.1    KQ973412    EFA12510.2    NEVH01023961    PNF17613.1    GGFJ01001842    MBW50983.1    GGFJ01001844    MBW50985.1    NEVH01006754    PNF36554.1    GGFJ01001843    MBW50984.1    NEVH01011193    PNF32021.1    GGFJ01001857    MBW50998.1    NEVH01021205    PNF19912.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NWSH01000032    PCG80497.1    GBGD01000880    JAC88009.1    NEVH01011985    PNF31054.1    GBGD01000799    JAC88090.1    GFTR01008262    JAW08164.1    GGFJ01001858    MBW50999.1    NEVH01019080    PNF22876.1    GGFL01004957    MBW69135.1    JXUM01241784    KQ635293    KXJ62492.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    NEVH01019376    PNF22596.1    GGMS01002992    MBY72195.1    GEZM01074951    JAV64378.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GBGD01000881    JAC88008.1    ABLF02020655    ABLF02039168    ABLF02061060    ABLF02017815    NEVH01026154    PNF14491.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF10551   MULE
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.026089,     Score=90

Ontologies

Topology

Length:
593
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
13.0204
Exp number, first 60 AAs:
0.00329
Total prob of N-in:
0.50450
outside
1  -  593
 
 

Population Genetic Test Statistics

Pi
31.280891
Theta
2.295423
Tajima's D
0
CLR
0.027747
CSRT
0.413279336033198
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号