SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11845
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
RNA-directed DNA polymerase from mobile element jockey       + More
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.829
 

Sequence

CDS
ATGGATTTCGAATCCGCGTCAAGCCCTCAGCCTGGAACTTCGGATGGGTTCCAAACCGTAACGCGCGGTAAAAAGCGTACTCGCGCCGTGGAGTCCCGGAACTCCACGACAAAACAAACGAAATCCGCGTCCGCCTCTCGACCAAAAGTAGTAGTAACACCGGAGTCGGACTCCGCGCGCCGCGTAACCCCACCGCCGCGTCCCAAGCCCGCGCCCGCTCCCAAAGTAGCTGCCCCGCCCCCGCTGATACTTCAAGAGAAGACAGCGTGGAATCGCGTGTCCCAGGCCCTTCAGGCAAATAAAATTAACTACACCCATGCGCGTAACGTCGCGCATGGGATTCAGATCAAGGTCGCAACGCCGGGCGACCATAGGGCCCTCTCAGCATACCTCCGAAAGGAGAACATAGGTTTCCACACCTATGCTCTTCAGGAGGACCGCGAGCTCCGCGTAGTAATACGCGGAGTCCCTAAGGAGCTAGAAATAGACTACATTAAGGAGGATCTGACCGCTCAGGCCCTCCCGATAGTTAGTGTGCACCGGATGCACAGCGGGCGGGGCAAACAGCCCTATAATATGATACTCGTGGCGTTAGAACCCACCCCGGAGGCCAAAAAGAAGATCGCATGTCTCACGACAATTTGCGGCCTATCCGGGATATCGATCGAAGCCCCCCATAAGCGTGGCACTCCCGGGCAGTGCTACAGGTGCCAACTCTATGGCCACTCGGCGCGTAACTGCCACGCGCGCCCCCGCTGCGTGAAATGCCTCGGCGATCACGCTACCAAGGGCACCCCGCGAACTACCGTGGATGTCCCAGGGCTCCGCGAAAACGCCCAACCCACCCAGCTCCGCGAACCGTCGGCCCAAAGACTTCGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTCCTGAGCAGTGACATCGAGTCACTGCTCGGCATGGGAGACTCTGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACAAACGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACCTTCGAAATAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTTAGGAACGTAACTCTGCGCTTGCGTTCCATCGAAGCAATGTCAGAGCTCGACTCAGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCTCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGACGCCGCTCCGCCAATCCTCCCTTACGGCCCGGATTCGAATCCATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATCTCTTCCGCGATCATTAGATCTTCTAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCCCCGATCTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTCAGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCTTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCTTACGCCCTTCAGGCCAACCACCGGCATTCGACGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAATGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCACAGAGCCTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACGGACGAAGTTAGAGACGCGATCCACAACCTCCAACCTAGGAAGGCACCAGGCTCCGACGGCATCCACAACCGCGCGCTAAAATTTTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGACAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCTCGACGATAGGAAAAATCTACGAACGGCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAATTCGGATTCCGCTCTAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATTCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTATAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACCGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGAATAGACATCAACCCCACGAAAAGCGCAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACATCACTTCGAGCATCCCACTCCGTAGTAGGCGCGCAAACACCTCCGCCGTTAGTCCCATCACTCTCTTTGGCCAGCCCATACCGTGGGTCTCGAAGGTCAAATATCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATAAAAACGGTACGCGACCGCGCCGCGTTTATTCTAGGACGACTCTATCCAATGCTTTGTTGTCGAAGCAAGCTGTCCCTCCGTAATAAGGTAACTCTCTACAAAACTTGTATACGCCCCGTCATGACGTATGCAAGTGTAGTGTTCGCTCACGCAGCCCGCACCAACTTGAAATCCCTTCAGGTTATTCAATCACGATTCTGCAGGATAGCCGTCGGAGCGCCTTGGTTCCTTAGGAATGTGGATCTCCACGACGACCTGGAGCTCGACTCTGTTAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGGAATCAAAAAGTGACATCGTTTTACTTGGTGTTCAACAAGATAATGTCTACCCTCAAGCCTACATACTCTATTACGTCTATAATGGCTATGGACTCCGATAA
Protein
MDFESASSPQPGTSDGFQTVTRGKKRTRAVESRNSTTKQTKSASASRPKVVVTPESDSARRVTPPPRPKPAPAPKVAAPPPLILQEKTAWNRVSQALQANKINYTHARNVAHGIQIKVATPGDHRALSAYLRKENIGFHTYALQEDRELRVVIRGVPKELEIDYIKEDLTAQALPIVSVHRMHSGRGKQPYNMILVALEPTPEAKKKIACLTTICGLSGISIEAPHKRGTPGQCYRCQLYGHSARNCHARPRCVKCLGDHATKGTPRTTVDVPGLRENAQPTQLREPSAQRLRHQPIVIASVYLPPDKPLLSSDIESLLGMGDSVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPHNPVTVTRTMVDWNKLGTCLADAAPPILPYGPDSNPSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSPDLRNLLRVRNAAIRAYDRLPTHSNRIQMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLLRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVEHRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIHNRALKFLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPTNETSSYRPISLLSTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATMGQWFRKWRIDINPTKSAAVLFKRGRPPNITSSIPLRSRRANTSAVSPITLFGQPIPWVSKVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCCRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKSLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSVSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMESKSDIVLLGVQQDNVYPQAYILYYVYNGYGLR

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    GALX01005299    JAB63167.1    ABLF02042518    ABLF02057746    GALX01005359    JAB63107.1    KK119261    KFM75202.1    GFTR01008038    JAW08388.1    GGMS01006359    MBY75562.1    GGMS01002992    MBY72195.1    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02028535    ABLF02028545    ABLF02034467    GFTR01008279    JAW08147.1    GGFJ01001842    MBW50983.1    GGMR01003407    MBY16026.1    GGFJ01001843    MBW50984.1    GGFJ01001844    MBW50985.1    GGFJ01002256    MBW51397.1    GGFJ01002257    MBW51398.1    NEVH01006736    PNF36716.1    GEZM01053022    JAV74219.1    NEVH01011985    PNF31054.1    GGMR01000676    MBY13295.1    NEVH01026386    PNF14434.1    GGFL01005012    MBW69190.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    GGFL01004957    MBW69135.1    GFTR01008262    JAW08164.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GFTR01008271    JAW08155.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GFTR01008251    JAW08175.1    KK119692    KFM76444.1    GBGD01000415    JAC88474.1    NEVH01021205    PNF19912.1    NEVH01022639    PNF18527.1    GGFJ01001858    MBW50999.1    GGMS01017365    MBY86568.1    GGFJ01001857    MBW50998.1    GFTR01008256    JAW08170.1    GFTR01008261    JAW08165.1    GEZM01084969    JAV60363.1    NEVH01017470    PNF24199.1    GEDC01000337    JAS36961.1    GFXV01000908    MBW12713.1    M38437    GGMR01012305    MBY24924.1    GBHO01008295    JAG35309.1    NEVH01020940    PNF20481.1    GFTR01008257    JAW08169.1    ABLF02040877    ABLF02040900    NWSH01007753    PCG62823.1    GFTR01008269    JAW08157.1    M22874    M38643    GGMR01006408    MBY19027.1    GGMR01003864    MBY16483.1    GGMR01016905    MBY29524.1    NWSH01000032    PCG80496.1    GECL01003538    JAP02586.1    GBGD01000389    JAC88500.1    AY060438    AAL25477.1    GFTR01008254    JAW08172.1    NEVH01016302    PNF25823.1    GGMR01000226    MBY12845.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.000347863,     Score=109

Ontologies

Topology

Length:
1134
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.27331
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00008
outside
1  -  1134
 
 

Population Genetic Test Statistics

Pi
17.635923
Theta
4.237406
Tajima's D
3.830874
CLR
2.244151
CSRT
0.998650067496625
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号