SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11843
Annotation
blastopia_polyprotein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.94
 

Sequence

CDS
ATGCCGCCGAAAAAAGACTTACAAGACGCTGAAGGTGAGGAACAGGAAGTAGACGTGCATATTTCATTCAAAGATTTGGAGAAGTCGATGAACATATTTACCGGAGATGACACCTACCCGATTGAGACATTTCTTGACGAATTCGAAGACGTAGCACAGATCATGAATTGGACTAAAGTCGAAAAATTGATTTACGCAAAAAGACTCTTAGAAGGAACTGCCAAGCTTTTCTTACGATCTATGGGAAGGATAAAAGACTACGCAACCTTGAAGAATGCTCTTAAAGAAGAGTTCGGTCCCAAAATTAACAGCGCAGTTGTACACAAAAAACTTGCTTCGCGTAAAATGAAGAATGACGAGACATATCAACAGTACTTCTTGTCGATGAAAGAATTAGCCCTACATGGTAAAGTTGAGGACGCTGCGCTAATAGAATACGTCATAGATGGCATTCGTGACATTGAAGCCAATAAAGCAATTCTGTACGGTGCAGCAGACATAAAAGAATTTCGAAAGAAGTTGGACATCTATAGTGAATTTAGAAAGAAGATGTCTGCTAGATCTTCTCATTCTGGCCAGTCGTCTGCAAGTCACATAACCCATAAGAAGACTCATGTGAAAAGGTGTTTCAACTGTGGCGACTTGGACCATCAAGCACCTGCCTGTCCAAAAGGAATCAAATGTTTTAAATGTAACGAGTTTGGCCACAAATCTACAGACTGTACAAGTAATAAAATCAAGAAGACTCTGAACATTCTAAATAAAAGTGAAGAAGAGAAAGTTCCCTACAAGAAGATAAAGATTAATGAAACAGAAATGATAGCACTAATAGACACAGGAAGCGATGTTAATTTGATTAGGATGACTGAAGCTGAAAGGATTACGAAAGACGCATTGAATAATCAAAATAACTCTAAGATATGCTTGACAGGTATAGCTGAAAAGGAGGTATACACAAAAGGAGTCTTTAATGCAAGATTACAAATAGATGATTGTTACGCTGATATAACATTCTACATTGTCCAAGATAATGACATACCTGTAAATGTAATTTTGGGAAACCCTATATTGAGAGAATTTGAAGTTAACTTTACTGCGAATGGGATATTTGTAGAAAAAATTGTATATCTCACGCTATTAACTGAAGAGAAAAATATCTACAATGAAAACGATACAATTAAATCAGAAAATTCAGACAAAATTAGAAAAATAGTAGAAGAATATAAACCTAACAAAGTAAAGAGAGAAAGTAACGTTGAAATGAAGATTATACTTACCGACGACGAACCAATACATCAAAATCCGCGACGACTTTCACCCCTGGAAATGAAGACGGTTAATGAACAGATAAAAGAATGGATAGAACAAGAGATAATACAACCAAGCAAATCTGACTACGCAAGCCCTGTGGTACTAGCTAATAAGAAAGATGGAACTTACCGACTATGCGTAGACTACCGAAGACTGAATAAGAAGATAATAAAAGACCGGTTCCCATTACCACTGATCGAAGACCAAATAGACAAACTAAAGGAAGCGAAAGTGTACTCGACGCTAGATTTGAAAAATGGATTCATGCACGTTAACGTCCATAAAGATAGCAGGAAGTATACGTCGTTTGTTACGCCCCAAGGCCAATACGAATTTCTTAAAATGCCCTTCGGTCTCTGCACAGCGCCATCTGTATTTCAAAGATTTATTAATAATATCTTTCAAGATCTTATCTCAGATGGCATTGTCCTGACATATCTCGATGATCTTATTGTTCCAGCAAAGACAGAAGAAGAAGGACTGATAAAGTTAGAAAAGGTATTTAAAAGAGCTGCAGAATTTGGTTTACAATTTAACTACAAGAAATGCCATTTCATGAAAAAAGAAATAGAGTATCTGGGCTATGTCATCAAAGATAATGAGGTTCGGCCATCAAAAGAAAAGATTGCCGCGGTGTCTAAATTTAAAATACCACACAATATAAAATTACTACAATCATTTCTCGGACTCACTGGATATTTTAGAAAGTTTGTAAGAAACTACTCTTTGATCGCAAAACCATTAACGAATCTTTTGAAGAATGATACTGAGTTCAATTTTGACGATGAATGTGAAAAGGCTTTTATTGAACTAAAGAAGATACTATGTGGATCGCCAGTTCTCCAAATTTTCAACCCCGATTATGAAACAGAAATTCATACAGACGCAAGCATGGATGGATACGGAGCTGTCCTATTACAGAAATGCCCTAAAGACAATCTAATGCACCCTGTTTATTATATGAGTAAGAAAACGACTCCAGCTGAGAGGAAATACCACAGCTATTATTTAGAAATTTTAGCTATAGTTGCTGCTATTAAGAAGTTCCGAGTTTACGTTTTGGGAATACATTTTAAAATAGTAACCGATTGTTCTGCCCTAACAATGACTTTGCAAAAAAAGGATCTGCCACCGAGAGTCGCCCGTTGGGCTCTGCTCCTCGAAGAATACGATTATGAAATTGAACACAGGCCAGGATCCAGAATGAAGCACGCTGACGCTTTGAGTAGAAATCCAGTTTGTTTAATTCTCACAGAAACGATGGCTCGTTTGAGGAAAGCACAGAACGAAGATGAACGAATAAGACTAATAAAAACAATTTTAGAGAAAGAAAATTATCAAGATTACATAATACAGCGAGACATACTTTACAAAGAGAAGGAAGGAAATAGATTGATTGTTATACCTAAGAAAATGCAGTACGAGATCATTCGTAAAAACCATGAGAGAGGACACTTTGGTATTACAAAAACAGAAGAATTAATCAACAGAGAATATTATATTGAGAATTTACAAGATAAGATAAGAAAAGTTATAGATAACTGCGTTGAATGCATTCTCATATCGCACAAGAGAGGTAAAAGGGAAGGACTATTACACCCGATAGACAAAGGCAATGTTCCATTATCAACATACCACATTGATCATCTCGGACCTTTGACATCTACTCATAAAAATTACAAGTATATCCTCACCGTTGTTGACGCTTATACCAAATTTACCTGGATTTACCCTGTTAAGACTCTTACCGCTCTAGAGACGGTAGAAAAGTTAAGACTGCAACAGCAAACTTTCGGGTCACCAGAAAGGATTATTACTGATCGAAACGCCGCATTTACTGCAAATGAATTTCAAGAGTACTGCCGTAATGAAAATATTACACACTATATGATTACTACAGGACAACCCAGAGGAAATGGCCAGGTCGAAAGGATTCATCAGATTATTATTGCCGTGTTGAGCAAGCTCAGCGCTGATGATCCGACCAAATGGTACCGCCGTGTGTCTGTAGTACAACGCTGTCTGAATGGTACCTACCAAAGAAGCATAGGAATGACGCCATTTGAATTACTCTTTGGCACTAAAATAAAAGATAAAGACGATGATGAACTTAAGAAGTTAATAGAGGAAGAAGAAATACAAATGTTTAAAGAAAAAAGACAAGAGCTGAGAGAAAAAGCTAAAGAATCGCTACTGAAGATACAAGAAGAAAACATAAAAAATTATAACAGAAAGAGAAAAGAAGCGACGTCTTACAAAGTTGGCGATCTAGTTGCAATCAAGAAAACGCAGTTCTCTCAAGGCAGTAAATTATTTCCTAAGTACCTAGGACCTTATGAAGTCTTAAAAAACAAAAGAAATGACCGATATGTTGTGAAGAAAGTTGGAAATACAGAAGGTCCAATCAACACGACTTCTTCTGCTGATTTCATGAAACCATGGGTCACGTCGGAAGAAAATTATTCATCTGGGTCAGATGATTAA
Protein
MPPKKDLQDAEGEEQEVDVHISFKDLEKSMNIFTGDDTYPIETFLDEFEDVAQIMNWTKVEKLIYAKRLLEGTAKLFLRSMGRIKDYATLKNALKEEFGPKINSAVVHKKLASRKMKNDETYQQYFLSMKELALHGKVEDAALIEYVIDGIRDIEANKAILYGAADIKEFRKKLDIYSEFRKKMSARSSHSGQSSASHITHKKTHVKRCFNCGDLDHQAPACPKGIKCFKCNEFGHKSTDCTSNKIKKTLNILNKSEEEKVPYKKIKINETEMIALIDTGSDVNLIRMTEAERITKDALNNQNNSKICLTGIAEKEVYTKGVFNARLQIDDCYADITFYIVQDNDIPVNVILGNPILREFEVNFTANGIFVEKIVYLTLLTEEKNIYNENDTIKSENSDKIRKIVEEYKPNKVKRESNVEMKIILTDDEPIHQNPRRLSPLEMKTVNEQIKEWIEQEIIQPSKSDYASPVVLANKKDGTYRLCVDYRRLNKKIIKDRFPLPLIEDQIDKLKEAKVYSTLDLKNGFMHVNVHKDSRKYTSFVTPQGQYEFLKMPFGLCTAPSVFQRFINNIFQDLISDGIVLTYLDDLIVPAKTEEEGLIKLEKVFKRAAEFGLQFNYKKCHFMKKEIEYLGYVIKDNEVRPSKEKIAAVSKFKIPHNIKLLQSFLGLTGYFRKFVRNYSLIAKPLTNLLKNDTEFNFDDECEKAFIELKKILCGSPVLQIFNPDYETEIHTDASMDGYGAVLLQKCPKDNLMHPVYYMSKKTTPAERKYHSYYLEILAIVAAIKKFRVYVLGIHFKIVTDCSALTMTLQKKDLPPRVARWALLLEEYDYEIEHRPGSRMKHADALSRNPVCLILTETMARLRKAQNEDERIRLIKTILEKENYQDYIIQRDILYKEKEGNRLIVIPKKMQYEIIRKNHERGHFGITKTEELINREYYIENLQDKIRKVIDNCVECILISHKRGKREGLLHPIDKGNVPLSTYHIDHLGPLTSTHKNYKYILTVVDAYTKFTWIYPVKTLTALETVEKLRLQQQTFGSPERIITDRNAAFTANEFQEYCRNENITHYMITTGQPRGNGQVERIHQIIIAVLSKLSADDPTKWYRRVSVVQRCLNGTYQRSIGMTPFELLFGTKIKDKDDDELKKLIEEEEIQMFKEKRQELREKAKESLLKIQEENIKNYNRKRKEATSYKVGDLVAIKKTQFSQGSKLFPKYLGPYEVLKNKRNDRYVVKKVGNTEGPINTTSSADFMKPWVTSEENYSSGSDD

Summary

EMBL
GBBI01004549    JAC14163.1    GBBI01004613    JAC14099.1    ABLF02014660    ABLF02042774    + More
GBXI01005773    JAD08519.1    LBMM01010976    KMQ87102.1    ABLF02005846    GBBI01004477    JAC14235.1    GBBI01004551    JAC14161.1    GBBI01004550    JAC14162.1    GEHC01000930    JAV46715.1    LBMM01005919    KMQ91096.1    LBMM01011782    KMQ86633.1    KMQ91095.1    GAMC01007326    JAB99229.1    GBXI01004632    JAD09660.1    GAMC01015907    JAB90648.1    ABLF02005127    ABLF02005129    ABLF02007401    GAMC01020207    JAB86348.1    GGFK01005990    MBW39311.1    GAKP01019383    JAC39569.1    GBXI01015151    JAC99140.1    GAKP01016235    JAC42717.1    GAKP01016237    JAC42715.1    Z27119    CAA81643.1    GGFL01001689    MBW65867.1    AY050234    AAK84933.1    GFTR01008753    JAW07673.1    GEZM01033083    JAV84424.1    GGMR01005091    MBY17710.1    GFXV01005120    MBW16925.1    ABLF02041876    GGMR01015682    MBY28301.1    GGMR01003388    MBY16007.1    ABLF02008401    ABLF02008404    ABLF02004401    ABLF02013544    ABLF02013550    ABLF02033943    ABLF02042737    GEHC01000880    JAV46765.1    GGMR01009949    MBY22568.1    ABLF02017401    ABLF02003120    ABLF02004015    ABLF02057179    ABLF02066208    GGMR01016004    MBY28623.1    GEHC01000888    JAV46757.1    ABLF02022032    GEHC01000876    JAV46769.1    LBMM01008871    KMQ88569.1    GBYB01013920    JAG83687.1    GGMS01012726    MBY81929.1    KQ460883    KPJ11409.1    GEHC01000891    JAV46754.1    KA649989    AFP64618.1    EF710649    ACE75273.1    ABLF02024793    LBMM01006880    KMQ90234.1    GAKP01001563    JAC57389.1    ABLF02008946    GGMR01014665    MBY27284.1    GGMR01015939    MBY28558.1    GBHO01040010    GBHO01001812    JAG03594.1    JAG41792.1    ABLF02002940    ABLF02002941    ABLF02002942    ABLF02048237    ABLF02057838    ABLF02061919    ABLF02067277    GGMR01000717    MBY13336.1    ABLF02028808   
Pfam
PF17917   RT_RNaseH        + More
PF00078   RVT_1
PF00098   zf-CCHC
PF00665   rve
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF02037   SAP
PF09668   Asp_protease
PF00077   RVP
PF03732   Retrotrans_gag
PF12384   Peptidase_A2B
PF13873   Myb_DNA-bind_5
PF16064   DUF4806
Interpro
IPR000477   RT_dom        + More
IPR041373   RT_RNaseH       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR036361   SAP_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR003034   SAP_dom       
IPR019103   Peptidase_aspartic_DDI1-type       
IPR018061   Retropepsins       
IPR005162   Retrotrans_gag_dom       
IPR024650   Peptidase_A2B       
IPR034145   RP_RTVL-H-like       
IPR028002   Myb_DNA-bind_5       
IPR032071   DUF4806       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
SSF68906   SSF68906       
Gene 3D
PDB
4OL8     E-value=3.62673e-74,     Score=712

Ontologies

Topology

Length:
1264
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00314
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1264
 
 

Population Genetic Test Statistics

Pi
184.97284
Theta
65.206464
Tajima's D
3.303166
CLR
0.35617
CSRT
0.989750512474376
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号