SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11835
Pre Gene Modal
BGIBMGA014054
Annotation
PREDICTED:_facilitated_trehalose_transporter_Tret1_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 4.868
 

Sequence

CDS
ATGGAAAGATTTAACCTTATTGCAATTGAGGATTTGCCCGCTGGGGAACCGATAGAGCAGGCATTGACGGAGCGAAGTAAGCGTTCATGGAACCCCCGAAATTATGAACCTGACGGAGAGGACATTCCAGTAATTTTGTCTTCACCTGCGATTCCGCCATCACCGGCAATGTACGTTGAATGTGGCGGCAGTGGTACGAGCACGCCATCTTCTAGATATAATATACAGATTTCTGTACATGGCAGCCGTAGTCCTTCGCCGTCACATAAACGTGTGCGTCGATCGCTTTGCCCAGACCAAGAACATGATACTACGAACAGAGATTCTATTTCATCGCTACGTCGACCGCTACGAGACTCTGAAATTTGCTACTTGTTGCACTATGGAAGTGACGACGATGACAGCGATGATGAGAGCCAGAATGATAACGACGAAATCGTTCCCATGATTATCCCCCGGGCAGCTGGAATACTGATGGACACTCCGGACGACGAGGAGATTGAGATTGACACGGCGGCGGCAACTAAACCTCTTGTGACATCTTCCGCGCCTTCCATCATTTCAGCACCTACATCACCAGCGCGTGATACCGGTATGAAGCCTAGTCATTTTTTTGAATTTGACTGGGGAACTTTCCCTGACTCTCCTATACCGCCAACAGAAAGGCGTGAATCTTTTAAGGAACACTCTGGTCCCACTGTTGCTGTAAGTGACCCTTACGAGATTTTTAGACTTATTTGGGACCAGGAGTTCATGGAATTTATTGTGCAGGAAACAAATAGATATGCCCAACAATTAGCTGCTGAAATGTTGGACGGCGGGGAATTACAGGCCTCCAGTAGGATTACAGAATGGAAAGAAACCAATGTAGACGAGTTATTGGTGTTCTTCGGAATATTACTGGCGATGGGAATCGTCATAAAGAACCGGGTTGAAGAGTACTGGAATACGGAACAAAACATCTTCTCCACTCCAGGTTTCAAAGTATATATGTCGCTTAGGAGGTTCCAGTTACTCAGCAGGTGCTTACATTTTAATAATTCCGAGAACTTGAGAAACCTCAACCTGGATCCCTCACAGGCAAAGCTTTTTAAAGTGGAGCCTGTGATTAGCCATTTGAATTCCAAGTTCACGGAATTATATATAATGAAGCAGAACATTGCTTTAGATGAATCGCTGCTGCAGTGGAAAGGTTGGTTGAACATCAACCAATTTATTCCAAACAAAGCTGCAGCAGTGGGCATAAAAACTTACGAAATATGTGAGTCGCAGACGGGGTATTTATGGCGATTTAAAATCCATGCCCATAAGGCTTCGCCTACAGTCTCAGAGGCTGATCCATTCACAGCGAGTACACCGGCGTTGGTTCTTAACCTTATCAAAGGTTTAGAACACAAAGGATACACGTTGTGGATGGATAACTTCTACAATTCCCCAGCACTTGCCCGAAAACTCAAATCGATTGGGTTTGATTGTGTCGGTACGTTGCGGACAAACCGCAAGTATGTCCCGACGGAACTGACCAATCTGAAAAAATCTCAGATGAAGCCCGGGCAAGTAGTAGGCTATACCAGTGGAGATGTCGATTGCATAATATGGAGAGATCAGAACCGCGTAGCGACGATCTCAACGTACCATGGCAATGCCGTCTCCACTAAAAACGGAGTAACAAAACTTATTTTGATACGTGACTACAACATCTGCATGGGTGGCGTGGATAAAAAAGATCAGATGTTGGCTGCATTCCCAATTGAACGCAAGAGGACACAAATTTGGTACAAGAAATTGTTTAAAAGGCCGATGTCTGCGTGGGAGATATCACTACTGGGCAGCTTGCCTAACTTCGGAGCACTGTTGGCTAGTCCCTTCTGTGGACTCGCCTTCAACATTTTAGGAAGAAAATACGCTACGATATTCTTCGGTCTACCTTACGTGATCACATGGACAATAATATCTCTTACGGATAATGTGATCCTAGTACTTGTGGCCATGTCGATCGCGGGTGTGGGCGTTGCGGGGCAAAACGTTGCAATAATTTACGTGTCAGAAATCGCTCATGATTCAATCCGAGGTGGTCTCACGGCATTCTCATCATCGGGGTATATCATAGGGCTTTTGACGTCATACATCTTGGGAGGAAAACTGACGTATCAACAGGTTGTTTATACGCATTTGGGGTTCTCAGTAATGACGATGCTGTTGTTGACCTTACTCCGCGAGAGTCCTGTGTTCCTGGTAATGAAAGGCAGGGAAGAAGAAGCGGAAAAATCTATAGCGTTCTATAAAAGATTGAAAATCGGTTCAAAGGACATAGCATTTGAAATTGACAAAATCAGATTGCAGATTAATCCTAGTTCCGAGAAAACTTATCTACCTGTAGATACTGAAGAAGCAAAAGATTTAGCGAAACATGAAGAGCAACAAGTTGAACAGAAACCGACATCGTCTTGGAAATTTTTGATGAAGTCAAAGTCTTCACAGCGCGCCCTGGCCACAGTGCTAATAATCATGACCCTGATCATATTAATGGGCTGCGTGGTGCTACAAGTGTATGCCGAACCGCTCTTCAAAGAAGCTGTACCTTCGATGCCGCCGAACCAATGCGCCATATTACTCGCTGTGGACTTTTTAATTGCCAGTCTCGTTTGTGTATTTATTATTGATAAGTTTGGCAGAAAGCCCCTGCTAATAGTGACGGCAGCAATTTCGGGCGTCTGCATGTTCCTGCTGGGCTTGCAACTGCAGACACATTTCGCGCCACATTGGTTCACGGTGCTAATCATCTACACGTACAGCTTCGTCTACATGCTGGGCTGCGCTGCTATACCGTTCGTATTGAGCGCCGAACTTTTCTTGCCGGAGGTGAGGAGTCTCTGTAATAGCATCACAATGGTTTGCCTTTGGTCGGTCAATTTTGTGACTCTTCTGGTGTTCAAGCCGCTGGCGGAATGGCTGGGCCTCGGAATAGTGTTCTACTGCTTTTCAATGTTCAGTTTCGTGGGAGTTTTATTTGGCTACGCATACATACCGGAGACGAAAGGTTTATCAGTGGACGCGATACAGTTATTATTTTTGAAGAAAAAATAG
Protein
MERFNLIAIEDLPAGEPIEQALTERSKRSWNPRNYEPDGEDIPVILSSPAIPPSPAMYVECGGSGTSTPSSRYNIQISVHGSRSPSPSHKRVRRSLCPDQEHDTTNRDSISSLRRPLRDSEICYLLHYGSDDDDSDDESQNDNDEIVPMIIPRAAGILMDTPDDEEIEIDTAAATKPLVTSSAPSIISAPTSPARDTGMKPSHFFEFDWGTFPDSPIPPTERRESFKEHSGPTVAVSDPYEIFRLIWDQEFMEFIVQETNRYAQQLAAEMLDGGELQASSRITEWKETNVDELLVFFGILLAMGIVIKNRVEEYWNTEQNIFSTPGFKVYMSLRRFQLLSRCLHFNNSENLRNLNLDPSQAKLFKVEPVISHLNSKFTELYIMKQNIALDESLLQWKGWLNINQFIPNKAAAVGIKTYEICESQTGYLWRFKIHAHKASPTVSEADPFTASTPALVLNLIKGLEHKGYTLWMDNFYNSPALARKLKSIGFDCVGTLRTNRKYVPTELTNLKKSQMKPGQVVGYTSGDVDCIIWRDQNRVATISTYHGNAVSTKNGVTKLILIRDYNICMGGVDKKDQMLAAFPIERKRTQIWYKKLFKRPMSAWEISLLGSLPNFGALLASPFCGLAFNILGRKYATIFFGLPYVITWTIISLTDNVILVLVAMSIAGVGVAGQNVAIIYVSEIAHDSIRGGLTAFSSSGYIIGLLTSYILGGKLTYQQVVYTHLGFSVMTMLLLTLLRESPVFLVMKGREEEAEKSIAFYKRLKIGSKDIAFEIDKIRLQINPSSEKTYLPVDTEEAKDLAKHEEQQVEQKPTSSWKFLMKSKSSQRALATVLIIMTLIILMGCVVLQVYAEPLFKEAVPSMPPNQCAILLAVDFLIASLVCVFIIDKFGRKPLLIVTAAISGVCMFLLGLQLQTHFAPHWFTVLIIYTYSFVYMLGCAAIPFVLSAELFLPEVRSLCNSITMVCLWSVNFVTLLVFKPLAEWLGLGIVFYCFSMFSFVGVLFGYAYIPETKGLSVDAIQLLFLKKK

Summary

Uniprot
ProteinModelPortal
PDB
4ZWC     E-value=7.27122e-17,     Score=217

Ontologies

Topology

Length:
1028
Number of predicted TMHs:
11
Exp number of AAs in TMHs:
237.54572
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00196
outside
1  -  605
TMhelix
606  -  628
inside
629  -  634
TMhelix
635  -  652
outside
653  -  656
TMhelix
657  -  679
inside
680  -  691
TMhelix
692  -  711
outside
712  -  720
TMhelix
721  -  738
inside
739  -  829
TMhelix
830  -  852
outside
853  -  866
TMhelix
867  -  887
inside
888  -  893
TMhelix
894  -  916
outside
917  -  925
TMhelix
926  -  948
inside
949  -  954
TMhelix
955  -  977
outside
978  -  986
TMhelix
987  -  1009
inside
1010  -  1028
 
 

Population Genetic Test Statistics

Pi
205.085331
Theta
145.845751
Tajima's D
0.396557
CLR
0.532338
CSRT
0.485675716214189
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号