SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11829
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.116 Nuclear   Reliability : 1.265
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAGCACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCTCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGAATTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTAA
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGLSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLREFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVY

Summary

EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    GBBI01004395    JAC14317.1    GGMS01006359    MBY75562.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGMR01018716    MBY31335.1    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02042518    ABLF02057746    GALX01005359    JAB63107.1    GGMR01004661    MBY17280.1    GGMR01015412    MBY28031.1    NEVH01005277    PNF39135.1    NEVH01011985    PNF31054.1    NEVH01021205    PNF19912.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    GFTR01008279    JAW08147.1    GFTR01008262    JAW08164.1    ABLF02028535    ABLF02028545    ABLF02023911    GFTR01008038    JAW08388.1    ABLF02034467    ABLF02041767    ABLF02040174    ABLF02040183    ABLF02055266    GGMR01002322    MBY14941.1    GGMR01013409    MBY26028.1    NEVH01002556    PNF42024.1    KK118005    KFM71947.1    ABLF02024246    GEDC01029594    JAS07704.1    KK119261    KFM75202.1    NEVH01017470    PNF24199.1    ABLF02042385    GFTR01008271    JAW08155.1    GFTR01007929    JAW08497.1    GGMS01017365    MBY86568.1    GFTR01008256    JAW08170.1    NEVH01006736    PNF36716.1    GGMR01000226    MBY12845.1    KK113281    KFM59799.1    GFTR01008251    JAW08175.1    GGMR01012443    MBY25062.1    NEVH01023280    PNF18085.1    GBBI01004571    JAC14141.1    GFTR01008261    JAW08165.1    GFTR01008260    JAW08166.1    GGMS01002786    MBY71989.1    GGMS01002992    MBY72195.1    GGMR01006581    MBY19200.1    GGMR01016905    MBY29524.1    GFTR01008257    JAW08169.1    GFXV01000908    MBW12713.1    GGMR01003864    MBY16483.1    GFTR01008151    JAW08275.1    GGMR01000676    MBY13295.1    ABLF02016634    KK115285    KFM64681.1    GGFL01005012    MBW69190.1    GFTR01008246    JAW08180.1    GGFL01004957    MBW69135.1    GEZM01053022    JAV74219.1    NNAY01003095    OXU19992.1    GECL01003538    JAP02586.1    GFXV01002840    MBW14645.1    RSAL01000708    RVE41206.1    NEVH01022639    PNF18527.1    GGMR01003407    MBY16026.1    GEZM01084969    JAV60363.1    GGMS01002955    MBY72158.1    ABLF02041861    NEVH01016302    PNF25823.1    ABLF02013806    ABLF02016612    GEZM01021881    JAV88842.1    GGMR01011511    MBY24130.1    GGMR01012676    MBY25295.1    GGMR01012305    MBY24924.1    ABLF02014118    ABLF02014121    ABLF02054790    GDHC01018248    JAQ00381.1    GGMR01006408    MBY19027.1    ABLF02022418   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR013083   Znf_RING/FYVE/PHD       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
628
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
6.1731
Exp number, first 60 AAs:
0.05462
Total prob of N-in:
0.03617
outside
1  -  628
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
21.649184
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号