SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11823
Annotation
hypothetical_protein_RF55_12429_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 1.923
 

Sequence

CDS
ATGAATGGTAGCTCCGTAGTTCTGCTGGCTACTGCTAACGTTGAAGTGCGCGACTCATCTGGTCACTTTCATACTCTTCGCGCACTCATCGACCCTGGTAGTCAGTCACATTTCATTTCTAATCAAGCTATGGAACGATTGGGCTTAAAGCCTAAGCAAACTTCGCGAAATGTTTGTGGCTTGGGGCAATCATCGACGTCAGTGACTGGAATGGTGGAGCTTCAACTCGGAGTTCATCAAAAGAATTTATTTAATTTAACGGCTCTCATCTTACCATCTATTTGTGCACAAATGCCCACTGCTCGTCTTGATCTTTCTTCATGCGAACACCTACGTAATTTGCGACTCGCTGATCCGAATTATAATAAGCCTGGACCAATAGATCTGCTTATCGGTGCTGAAATGTTTTCAACGTTGTTGCTGCCCGGAAATATTTCAGGTAGTCCTCATGAACCCTCAGCCTTGAACACCATCTTCGGATGGATCCTGATGGGAAGTGTCAAATGCAGGGATGAGACAAAACACTCAAATTCTTTTTTTCTAAGAGAACACGATACTCCTCTCCATGAGGATTTGAGGAGACTGTGGGAGTTGGAGGTCATACCTAAATCATCAGTTCTAGCGCCGGACGAGCAGCAATGTGAGAAACTTTTCACTGAAACCCACGCTCGAGGTACATCTGGAAGGTACATCGTTTCTTTGCCGTTTAGGCAGAGGGATGGGGAGTTACAGTTTCCGGGTTCGCGTGAAAATACATTGCGAAGATTCCATTCATTGGAACGAAGACTTCTTTCAAGTCCAAACCTTCATCAGCAGTATTCGGACTTCATGCTGGACTACTTAAATGATGGTCATATAGGAGTATCCTTTTTATGTGCTAAGTCTCGCGTGGCCCCAATTAAGAGAGTTTCATTGCCGAGACTAGAGCTCTGCGCTGCGGTTCTGCTCGCTGACCTGCTCAAATTCGTAAAAGAAGTGTATGTACCGTTACTTCCGCTTTCTGATACATTTGCTTGGTCAGATTCAACGGTAACTCTGTCATGGATTCGTGGCCATTCCTCGCGTTGGAGAACATTTGTTGCTAATAGGGTTAGTCATATCCAAGAAACTGTCCCCGAAACTCACTGGAATCACGTGCGCTCTAATGAAAATCCTGCGGACATAGCTTCCCGCGGTATGTGTCCGAGCGACCTACTCCAGAGTGAGTTATGGTGGGCGGGACCGAGCTGGCTTCGGCAACCTTCATCTTCATGGCCTTCAAATTCCGGTCTCGAGGTGAACGAGACTGATATGCTTGCCGAGGAACGCTGTTTTTCGTTGATCGTGAATGATGAACCTAACTTTATCGATTCTTTGCTCGAAAGGTTTTCATCAATTCGTAAGGTTCAACGTATTATTGGTTATTGTCTTCGTTTTATCAGAAATGCTAACAAAAAACAGACACGTGTTCCGGGTACCTTTTTAGGTCGTGCAGAACTTCATGGGGCCCTGATGACGATTACCAAGCGAATTCAATTTCTCAACTTTCAGGATGAAATTCGTAAGCTCGAGAATGGTATACCATTACCCAAACCGTGGAGAAAACTCAATCCATTCCTGGACGACCAAGGAGTTGTCAGGGTGGGCGGCCGTTTGTCTCGTTCTGGTCTTGAGTTTAGTCATAAGCATCCTGCTCTGTTGCCGCGTCATTCTAGGTTCACATACATGATCATCGAAGCAATTCACAAAGAGAATTGTCATCCTGGGTTGGGAACGACACAATATCTTTTGATGCAGCTGTTTTGGGTATTCTCTTCTAAACGTGCTATTCGTCATTGCTTGTCAAAATGTGTTTCGTGTTATAAAACTAATCCGAAATTATTGGAACCATTCATGAGTGACTTGCCGGCTTCTCGTGTGAATCAAGTCAAACCATTCTCTATTGTTGGCGTGGACTACGCAGGTCCATTCCAAATCAAACTCGGTAAGCATCGCGGTGCCAAAATCGGTAAGGCCTATTTGTGCCTATTCGTATGTTTTAGTACCAAAGCAGTTCATTTGGAAGTGGTTAGTGAGCTCTCGTCCGAAGCCTTTATTGCTGCCCTGCGCCGTTTTGTTGGGAGACGCGGTAGGGTAAATGTTATACACTCCGATTGTGGTACGAATTTTATTGGAGCTCAGAAGATCCTTAATCTTTATATGCATTCTGCTTCTGAGTCTCAAAACATTCAATTTAAATTCAATCCCCCTTCTGCTCCACATTTCGGAGGTGTATGGGAAATACAAATTAAAGCAGCTAAAAGTCACTTACATCGTATTATAGGTAATCAAACTTTAACGTTCGAAGAGTTAACAACACTTTTCGTTCAAATCGAAGCTTTGCTAAATTCTCGGCCGCTTTGCTCTTTGAGTTCAGATCCTAACGATTTGAACGTTTTAACGCCTGGACATTTCTTGGTTCTGGAACCACTTACCGCCGTTCCAGATTCTAACTTGTTGGATGATCAGATGTCTAGATTGAATCGCTGGCAATTGATTCAACGTTTCCAGCGGCATTTCTGGCAACGCTGGAAGTCCGAGTATCTGCATTCCCTAACTCAGAGAGCAAAGTGGAACAAAAGGGGCGAAACTTTGAATGATGGTTCTGTTGTACTGATTAAGAGTGAAAGTACAATGCCGTTGCACTTGCCTTTAGCTCGTGTCTCCAAGCTTCACGCCAGCCCTGATGGCGTGGTTCGTATTGCCACTGTCCGTACAGCCAATGGCAAATTCTACACTAGGCCATTAACGAAGTTAGCTCCCCTACCTATTTATTCTGATTAA
Protein
MNGSSVVLLATANVEVRDSSGHFHTLRALIDPGSQSHFISNQAMERLGLKPKQTSRNVCGLGQSSTSVTGMVELQLGVHQKNLFNLTALILPSICAQMPTARLDLSSCEHLRNLRLADPNYNKPGPIDLLIGAEMFSTLLLPGNISGSPHEPSALNTIFGWILMGSVKCRDETKHSNSFFLREHDTPLHEDLRRLWELEVIPKSSVLAPDEQQCEKLFTETHARGTSGRYIVSLPFRQRDGELQFPGSRENTLRRFHSLERRLLSSPNLHQQYSDFMLDYLNDGHIGVSFLCAKSRVAPIKRVSLPRLELCAAVLLADLLKFVKEVYVPLLPLSDTFAWSDSTVTLSWIRGHSSRWRTFVANRVSHIQETVPETHWNHVRSNENPADIASRGMCPSDLLQSELWWAGPSWLRQPSSSWPSNSGLEVNETDMLAEERCFSLIVNDEPNFIDSLLERFSSIRKVQRIIGYCLRFIRNANKKQTRVPGTFLGRAELHGALMTITKRIQFLNFQDEIRKLENGIPLPKPWRKLNPFLDDQGVVRVGGRLSRSGLEFSHKHPALLPRHSRFTYMIIEAIHKENCHPGLGTTQYLLMQLFWVFSSKRAIRHCLSKCVSCYKTNPKLLEPFMSDLPASRVNQVKPFSIVGVDYAGPFQIKLGKHRGAKIGKAYLCLFVCFSTKAVHLEVVSELSSEAFIAALRRFVGRRGRVNVIHSDCGTNFIGAQKILNLYMHSASESQNIQFKFNPPSAPHFGGVWEIQIKAAKSHLHRIIGNQTLTFEELTTLFVQIEALLNSRPLCSLSSDPNDLNVLTPGHFLVLEPLTAVPDSNLLDDQMSRLNRWQLIQRFQRHFWQRWKSEYLHSLTQRAKWNKRGETLNDGSVVLIKSESTMPLHLPLARVSKLHASPDGVVRIATVRTANGKFYTRPLTKLAPLPIYSD

Summary

EMBL
GL442026    EFN64015.1    GECZ01006169    JAS63600.1    ABLF02035110    ABLF02067347    + More
LBMM01009403    KMQ88162.1    ABLF02017056    ABLF02006304    ABLF02036268    GGMS01010524    MBY79727.1    GBBI01004276    JAC14436.1    GGMR01000737    MBY13356.1    ABLF02030854    LBMM01012392    KMQ86241.1    LNIX01000063    OXA37199.1    ABLF02005684    ABLF02035780    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    QOIP01000012    RLU16284.1    LBMM01006490    KMQ90572.1    ABLF02027568    ABLF02027570    ABLF02027572    ABLF02066092    RLU15928.1    GALX01005107    JAB63359.1    GGMR01017890    MBY30509.1    ABLF02030698    ABLF02030705    ABLF02030709    LBMM01009551    KMQ88039.1    GDHC01006469    JAQ12160.1    LBMM01009898    KMQ87805.1    LBMM01009746    KMQ87900.1    ABLF02041863    LBMM01009688    KMQ87939.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    LBMM01009888    KMQ87813.1    LBMM01009964    KMQ87756.1    LBMM01009941    KMQ87772.1    GEZM01068861    GEZM01068860    JAV66730.1    ABLF02008594    LNIX01000069    OXA36894.1    LNIX01000016    OXA46198.1    LNIX01000002    OXA60848.1    DS497760    EFA13224.1    LNIX01000007    OXA51795.1    ABLF02041614    GGMR01002421    MBY15040.1    GEDC01022769    JAS14529.1    LBMM01009284    KMQ88247.1    LBMM01006099    KMQ90942.1    ABLF02013940    ABLF02036313    ABLF02066938    ABLF02066950    GEBQ01029803    JAT10174.1    ABLF02036131    ABLF02041527    ABLF02064049    LBMM01009645    KMQ87967.1    GGMR01010723    MBY23342.1    GEZM01021505    JAV88969.1    LBMM01010417    KMQ87475.1    GL769615    EFZ10365.1    GBHO01007402    GBHO01007399    JAG36202.1    JAG36205.1    QOIP01000010    RLU18065.1    LBMM01012188    KMQ86362.1    LBMM01007859    KMQ89359.1    GGMR01014165    MBY26784.1    GGMR01005535    MBY18154.1    GDHC01021148    JAP97480.1    IAAA01051064    LAA11179.1    GDHC01018560    JAQ00069.1    LBMM01006671    KMQ90403.1    GGMS01009443    MBY78646.1    GDHF01021473    JAI30841.1    GGMR01020500    MBY33119.1    LBMM01010405    KMQ87487.1    LBMM01008129    KMQ89120.1    ABLF02039606    GFTR01008874    JAW07552.1    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    GBBI01004211    JAC14501.1   
Pfam
PF17921   Integrase_H2C2        + More
PF18701   DUF5641
PF05380   Peptidase_A17
PF00665   rve
PF05585   DUF1758
PF03564   DUF1759
Interpro
IPR001584   Integrase_cat-core        + More
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR040676   DUF5641       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR008737   Peptidase_asp_put       
IPR005312   DUF1759       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR000727   T_SNARE_dom       
IPR001878   Znf_CCHC       
IPR001969   Aspartic_peptidase_AS       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
Gene 3D

Ontologies

Topology

Length:
933
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0165
Exp number, first 60 AAs:
0.00013
Total prob of N-in:
0.00070
outside
1  -  933
 
 

Population Genetic Test Statistics

Pi
177.830999
Theta
140.125316
Tajima's D
0.601656
CLR
109.056851
CSRT
0.546172691365432
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号