SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11818
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 1.676
 

Sequence

CDS
ATGAACGAGCTGATCGGCGAGCTCAGTAGGACCAGGATTGGTTGTTTCATAGACGGGGTGTGCGTAAACAACATCAGCTACGCAGACGATATGGTGCTGCTGAGCGCGTCTATCTGTGGCCTAAGGCAACTTGTTTCTTTGTGTGAGGGATACGCCAAACCACACGGTTTGGTGTACAACTGTAAAAAGTCGGAGATCATGGTCTTTGAGACCAGGGGTGGGACGCATGATAAAATACCTCCCGTAGTACTCAACGGAACGCCATTGACAAGAGTTTATAAATTTAAATATCTCGGCCATGTGTTGACCCCTGATCTCAAAGATGATGAAGATATTGAACGAGAGCGGAGAGCGTTGTCGGTTAGAGCAAACATGATAGCTCGCAGGTTTGCACGGTGTTCACTTAAAGTCAAGGTCACCCTCTTTAGGGCCTACTGTACTAACTTTTACACGTGCAGCTTGTGGGCTGGATACACTCAAAGATCGTACAATGCTCTCCGTGTTCAATACAATAACGCGTTTAGGATGCTGGTGGTGCTGCCCCGCTTTTGTAGCGCATCAGGGATGTTTGCAGACGCGTACATAGATTGTTTTTACGCTACCATGCGTAAGAGGTGTGCATCTCTGGTAAACAGAGTGAGGGCCAGCTCCAACAGCATCCTGAGCATGATCGCAAGCAGGCTGGACTGTATATACATGGGTCGCTGTGGTGCCATCTCCCATGGGATGTTACCACAGGAGGGCCGCTCGACCATTGACGCGGTGATGCGCGTGCGCGCCCTCTCTGATGAGGCTGTCAGCCGGGGCGGGGTTGCACTGGCGGTGTCCCTGGACATCGCCAATGCGTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGCAGTATCACGGCGTCCCTGCGTATCTCCGTCGGCTGATCGGGTCCTACCTCGAGGATAGGGACTTGCGAGAGTCTGCCCGTCTTTCCTGCGCGGGGGTGTCCTTCGTCATCGGCAGGATCCGACGGTTGGGTCTGGAGGTGGCGCTTGATAAATCCCAGGCCCTGTTGTTTCACGGGGCCCGGAGAGCGCCGCCTCAGGGGGCCCACCTCGTGATCGGAGGCGTTCGCGTCGAGATCGAGGCAACCGGGTTGCGGTACCTCGGTCTCGTACTGGACGGTCGTTGGAGCTTCCGCGCTCACTTTGAAAGATTAGGTCCCCGACTGATGGCGGCTGCCGGCTCGCTGAGTCGGCTGTTGCCGAACGTCGGGGGGCCTGACGTGGTAGTGCGTCGCCTCTACACGGGGGTGGTGCGGTCGATGGCACTGTACGGGGCTCCCGTGTGGTGCCACGCCCTGACCCGTGACAACGTTGCGGCGTTGCGACGTCCGCAGCGCGCGATTGCGGTCAGGGCGGTTCGTGGATACCGCACCGTCTCGTTTGAGGCGGCGTGCGTGCTAGCTGGGACGCCTCCCTGGGACCTAGAAGCGGAGGCGCTCGCTGCGGATTACGCGTGGCGATGCGATCTCCGCTCCAGGGGGGAGCCGCGTCCCGGCGCGGCGGAAGTTCGAGCGCGGAAACTTCAATCTCGGCGTGCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCGGACCCCACCTACGGGCGACGGACTGTCGAGGCGATCCGCCCGGTCCTCTCGGACTGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGAGCGACGCAGGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCCGGAGGGAGCCGACGCCGAAGTGTCACCACTGCAGTGGCTGCAACGAGGACACGGCGGAGCACACGCTCGCGTACTGCACCGCTTTCGCGGAGCAGCGCCGCGTCCTCGTTGCAAAAATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTACGATGCTCGGCAGCGACGAGTCCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAACGGGAGAGGGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCGTCGAGCCGGGGTTCGGAGGAGGGCGTTTGTCCAGCTCCAGCCCCTATGA
Protein
MNELIGELSRTRIGCFIDGVCVNNISYADDMVLLSASICGLRQLVSLCEGYAKPHGLVYNCKKSEIMVFETRGGTHDKIPPVVLNGTPLTRVYKFKYLGHVLTPDLKDDEDIERERRALSVRANMIARRFARCSLKVKVTLFRAYCTNFYTCSLWAGYTQRSYNALRVQYNNAFRMLVVLPRFCSASGMFADAYIDCFYATMRKRCASLVNRVRASSNSILSMIASRLDCIYMGRCGAISHGMLPQEGRSTIDAVMRVRALSDEAVSRGGVALAVSLDIANAFNTLPWSVIAGALQYHGVPAYLRRLIGSYLEDRDLRESARLSCAGVSFVIGRIRRLGLEVALDKSQALLFHGARRAPPQGAHLVIGGVRVEIEATGLRYLGLVLDGRWSFRAHFERLGPRLMAAAGSLSRLLPNVGGPDVVVRRLYTGVVRSMALYGAPVWCHALTRDNVAALRRPQRAIAVRAVRGYRTVSFEAACVLAGTPPWDLEAEALAADYAWRCDLRSRGEPRPGAAEVRARKLQSRRAVLEAWSRRLADPTYGRRTVEAIRPVLSDWVNRDRGRLTFRATQVLTGHGCFGRYLHLVARREPTPKCHHCSGCNEDTAEHTLAYCTAFAEQRRVLVAKIGPDLSLPTVVATMLGSDESWQAMLDFCESTISQKEAAERERESSSSLSAPCRRRRAGVRRRAFVQLQPL

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
695
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.03931
Exp number, first 60 AAs:
0.02344
Total prob of N-in:
0.01941
outside
1  -  695
 
 

Population Genetic Test Statistics

Pi
1.296072
Theta
4.011175
Tajima's D
-1.812916
CLR
25.017766
CSRT
0.0203989800509974
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号