SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11813
Pre Gene Modal
BGIBMGA013664
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.275 PlasmaMembrane   Reliability : 1.465
 

Sequence

CDS
ATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGAACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTTCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACACTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATGATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGTCTTCGTGCCGGATGAAGTCGATTTCACGCGCCGCCAGCCAGTCTTGTATGCTCTTCGCTCTATGAGCTGGCGCCGAATTTTGTTGGAATACCCAGTGCCTGTTATTGAACATGGTATGAGAAACAGGTTCCACAAGAGAGAGTTAAACGCTGTGGACTTCAAGGTGTCTCAAGACTTGAAGTTCGTCTTGCTGATATCTGATGTGAGACCAGGCTGGAGGCATGGCCGTCTGGCGAGGTACCACGTCTATGACGTGATAAATAGGAATAAAATCCCCATATCGCCAGTGGAAGACGATCGTTCAGCGCCGCTGCTGCAGCACGCAGAGTGGTCCCCGGTCGGCTCCAGCTTAGTATTTGTACACGACAACGACATTTACTACAAGCCAAGAGTTTTGAAAACCCTGATTTGCAGGATCACTAAAGACGGTGTCCCGGGAGTAATATTCAATGGAGTACCAGATTTCTTATACGAGACCGAAGTGTTGCGGTTAGACCGAGCATTATGGTTCAGTCCGGACGGTCAGACCCTCATGTTCGCGACGTACAACAACTCCCAGGTCCAAGAACACAAATACCCGTGGTATGGTCTGGACGACCCCGAACCGCCCGCTTATCCCATAATTAAATCGGTCAGGTATCCCAAGGTGAACACCAACAACCCTGAAGTGACAATATACGTTGTCAGTTTAAAAACGCCGAAATATCTGTTCCCTCATGCGATCCAGTTTTCATCACAAGTGGACAAGACTTGGTACGTGCGCTGGACAGAGTGGATGTCGGAGAAGCAGATAGCAGTTCTGCTCCTCAACCGGGCTCAAAATGTTTCCATCATCAGCGTTTGCAGTGCAGCTCAATACAATTGTCAAGATATCTACCGCGACGAGACAGACGGCTCGCGCTGGTCAGGCCTCGGGGCTGAACCGGTGGAGGAAGACTGCGGGTGGTGCTTCGGACACGCCCTCGTCGGTTCTCGGTCGGGGATCTACACTACATCCCCCGTAGCAGACACAACTGGGATCTGGAGACATGCCGTCAAAGTGTCAATAGATGGAAGAACCCCTCTAACACAGGGCAGCTTTGAGATCACGCAGCTGCTAGGATGGGATGAGAAAAGGAAATTCTTGTACGTGGTGGGCACGGGGGTGGACAAGCCGGGGGAGAGACATTTGTACCGCGTCAGTGGGATCGAGCCGGGCGTGTGGACACCACCACCGGTCTGCCTCACCTGCTCAGTGTCACCAGCACCACCTACTACCACCGAAGCAGACCCGGACGATCTGGAATACGAGAACGGGACATCGTCCTTGCCGGCGTGGCCGTCCTCGACAGTACTCCCGCACGTTGCTGATGAGAACGACTCGCTGCCCGGCGAGTGTCTGTACAACAGGATCATGTTCAGCAAGAACTTCTCATATTACGTACAGGAGTGCCTGGGTCCCGGTCCTCCCGTGACGTTCCTGTGCACGCACTGGGGGGAGCGCCGCGCCGTGCTGTGGGACGGCTGGCCACTCAGACACAAGTTTGGACAACTGGCTCATCCGCAAGTCAAAGTGTTCAGGGTCGAGGTACAAGCAGAAAGGGAAGCCCGGGTCAGACTGCTACTGCCACCAGGGTTTAAGGAGACGGATGACCTGCCGTTACCGCTAGTGCTGCACGTGTCCGCTGAGCCCGGAGGTCAGCTGGTGACAGAGCGCTGGTCCCCGGGCTGGGGCTGGTACCTCGCAGCCACCAGGAACTTTATCGTCGCGCAGATCGACGCGCGCGGGTCCGGTGGACAGGGTGAGGAGCTGAGGACGGAGATATACCACAAACTGATGTCCATAGACGTGGAAGATCAAATTGCCGTCCTGTCGTATCTCCGCGACAACCTGAAGATGGTGGACGGTAGCCGAGTGGGGGTGTGGGGGCGCGGGTACGGCGGCGGTGCGGCGGCCGCGCTCGCCGCAGATGACGCCCGCAACGTGACGCGCTGCCTGGCCGCCGTGGCGCCACTGACCGACCTCAGACACCACAGTGAGTAG
Protein
MKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNDPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPVFVPDEVDFTRRQPVLYALRSMSWRRILLEYPVPVIEHGMRNRFHKRELNAVDFKVSQDLKFVLLISDVRPGWRHGRLARYHVYDVINRNKIPISPVEDDRSAPLLQHAEWSPVGSSLVFVHDNDIYYKPRVLKTLICRITKDGVPGVIFNGVPDFLYETEVLRLDRALWFSPDGQTLMFATYNNSQVQEHKYPWYGLDDPEPPAYPIIKSVRYPKVNTNNPEVTIYVVSLKTPKYLFPHAIQFSSQVDKTWYVRWTEWMSEKQIAVLLLNRAQNVSIISVCSAAQYNCQDIYRDETDGSRWSGLGAEPVEEDCGWCFGHALVGSRSGIYTTSPVADTTGIWRHAVKVSIDGRTPLTQGSFEITQLLGWDEKRKFLYVVGTGVDKPGERHLYRVSGIEPGVWTPPPVCLTCSVSPAPPTTTEADPDDLEYENGTSSLPAWPSSTVLPHVADENDSLPGECLYNRIMFSKNFSYYVQECLGPGPPVTFLCTHWGERRAVLWDGWPLRHKFGQLAHPQVKVFRVEVQAEREARVRLLLPPGFKETDDLPLPLVLHVSAEPGGQLVTERWSPGWGWYLAATRNFIVAQIDARGSGGQGEELRTEIYHKLMSIDVEDQIAVLSYLRDNLKMVDGSRVGVWGRGYGGGAAAALAADDARNVTRCLAAVAPLTDLRHHSE

Summary

Uniprot
ProteinModelPortal
PDB
1Z68     E-value=9.51926e-55,     Score=545

Ontologies

Topology

Length:
1395
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.59051000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04054
outside
1  -  1395
 
 

Population Genetic Test Statistics

Pi
173.999935
Theta
151.147804
Tajima's D
0.59545
CLR
0.143587
CSRT
0.542472876356182
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号