SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11783
Annotation
ORF_B_(bases_1850-5560)_first_start_codon_at_2306_[Autographa_californica_nucleopolyhedrovirus]
Location in the cell
Nuclear   Reliability : 3.803
 

Sequence

CDS
ATGTTAGCCCTAAGCCCACTACCGTCACAGTTGATAGAAAACAGTCAAAAGTACGAAATTAACAAAATTGAGACGGAATCTGACATAGATAAAGAACTTTGTGAAAATTTAAAGAAAATTCGTACCAGCCACATGAACGAGGAAGAAAAACGGGAAATTACCAAAATCTGCTATCAGTACCGTGACATATTCTACTCGGAAAACATTCCTTTATCGTTTACCCATACAGTAAAACACGAATTAAGACTAACCGACGACACCCCCATCTTTGTACGGAGTTATAGACAGGCTCCCCAACAACGAACAGAGATACAAAAACAGGTAGATAGTCTATTAAAACAAGGAATCATTAGGGAAAGTATCTCCCCTTGGTCGTGCCCGGTACACATTGTTCCGAAAAAACCGGATGCATCAGGAAAAGTTAAATGGAGACTTGTTATTGACTATAGAAGACTTAATGACAGAATTATAGAAGACAAGTACCCCTTACCAAACATTAACGACATCCTTGACAGATTAGGGCGCGCACAATATTTCACGACCATAGATTTAGCAAGCGGCTACCATCAATTAGAAATGCACCCTAAAGACGTAGAGAAAACAGCGTTTACTACTGAAAGAGGCCACTATGAGTTCCTAAGAATGCCTTTCGGACTAAAAAATGCCCCGAGCACTTTCCAGCGTCTTATGGACCATATACTCCGAGGTATAGACAACGTATTTATGTACTTAGATTACGTCATAATAGCCGCGACGTCCCTACAAAACCACAATGAAAAACTGAAATTAGTATTTCAGCGATTCAAAATGCATAATCTGAAAGTTCAGTTAGACAAATCAGAATTTCTACAGAAGCACGTTAACTTTCTAGGACATGAATTGACTGACCAAGGACTAAATCCTAACAAGGACAAAATTAAAGCAGTATTAAATTTCCCTATACCACAAACGCAAAAAGACATAAAAGCTTTCTTAGGCCTAGTCGGGTACTATAGGAAGTTTATTAAGGACTTCGCGAAGTTGACGAAACCTTTAACAGCATGTCTAAAAAAGAACGCAAAGGTTGAACATACAAACGAATTTTTAGACGCAGTTGATAAATGCAAACAAATTCTAACAAACGCCCCAATCCTGCAATACCCTGACTTCGACAAACCGTTTATTTTAACGACAGACGCATCTGACTTTGCTTTAGGAGCAGTACTTTCCCAAGGCAATGTGGGCTCAGATAAACCAGTAGCCTATGCCTCAAGGACATTATCAGATACTGAGATCCGTTACTCTACCATAGAGAAAGAACTGTTAGGGATAGTATGGGCAATTAAGTATTTTAGACCTTACTTATATGGCCGTAAATTTACAATTTATACGGACCATAGACCCCTTACATGGTTAATGAGTCTAAAGGACCCTAACTCTAAATTAACACGATGGAAACTAAAGTTAGCAGAGTATGATTACAAAGTTGTTTATAAAAAGGGCAAACAAAACACTAACGCAGATGCACTATCTCGAGCAAAAATTTTTCATAATAGTATAGATTCTCTAGCTGTTAATGTTGATGACAATAGTGACGACAACATAATAAATAGAATATTCGAAAACGCCCGTAGACAGGCAGAGGTAGAAACTGATGACCCGAATAACCAAGACAATGAACGTAACAATACTGACAATGACGACCAACCTTATAACAACAATGACGTAGAAATGACCAGTATCTATCCCTCTCAAATTGACGAAGAGACAGACACAAGGAGTGCAACAACAGTCGACCCCGATCAATTAGTTTCTACAAATCATACCCAACCTGATAATGAAAATAACGGTATCCCTATAATATCCGACGCTATTGATAGACAGTTGAAACAATTTTACGTTAGGTCCACACCAGGCTATACACCACGTGAGCTTTTATTCGGTCATACGGCATCCCGAAATCCATTAGAGCTATATTATCCTAAAGAATTTTATCAAGATTATGTCCTCAATCACCGCAAGAATGCAGAAGCAGTACAGGAATGTATAGCAGCCCACGTGTCTAAGAACAAAGAGCAGGTAATAGAAAAGAGAAACCAGGCAGCGGAAACAATCACGTTTAAGACCACATCTTGTTCCAGGGCCCTCATCGCAGGAGCCTTCGTACTCTACACAGCCGCCGACTTGACCCTTAATCCTATAGACAATACTAATGGCATCCTTTTGTTAAAACAAGGACAAATTTTGAAGCAGATAGACACTTTTAGTCTGGCCTGCGTATATAACGTATCGTATTTACATGAAACAACCTTAAAGCTTATGTCTTTATATGCCAGTACTAAAGCTGCTGAAGGTAACGAAGAGTTGCATAGAGCATATAAGGATCAAATAGAAAATAGTTTACATTTAATAGGGAAGAAGTTAGCATTTATTGCACCGCACCATAGATTTAGACGTGGCTTAATTAACGGTTTAGGTTCAGTAGTTAAAACTATTACAGGTAATCTGGATTATGAAGACGCTATTAAGTTTGAAAATGAATTATCTAATCTACGTAATTCAGTCCATAATATTAACACATCTCAAAAACAAACTTTATTCATAGCAAAGCACGCAGTTGAAGAATTTAGTAAACAGATCAAGTTATTAGACGAAAATCAGAAAAAGATAGGTTCAATGTTAAAAAACGCCACTTTAAGTAATAACGTAGTAATAAGCAGATTGCACTTTTTAGATTTATATATCCAAATATATTTTAGTTTGCAATTACTCTTAGATAAATTAGTTATATTAGAAGACGCCATGACCTTTGCACAACTAGAAGTAATGCATCCTAGCATTATAGCTCCACACAGTCTTATAAGTGAAATAACAGCTATTCAAAGACTTTACCAATTTAGACCCGTTGATAGAATAAGTATTAAAAATATTCATAGTATAGAGAGCTCTATTAGCGTAAAAGCGTATAGCACAAACGACGCACTAACATTCATACTAGATATCCCTTCCATAGATGAAAACCTTTATGACCTTATCCATCTATACTCCATACCAGATAAACAAAACCTCACCATTATTCCTAAATCCAAATACCTAGCACTGGGAACCAACGAGTACTCATACCTGGAGGAAGATTGCAAGAAGATCACACAAGACGTCCAACTCTGCACATCGCTGAACACCCAACCTGTGGAGAACTCTGAAGACTGCATAGTAACTCTTATAAAACACGAGAGCACAAACTGCACCCGTGCCAGGATGAACCTGAAACAAGGCAAGATCCAGAGACTAGAAGACAACAAATGGCTTATCATCTTGAAAGACGAACAAATCCTGAAATCTCGCTGCGGAAGGAAATCTGACTATAAAAAGTTGTCAGGAATATACATCGCCAGCATTACAAGCGATTGTCAAGTGGAAATATTCAACCGAACACTGAAGACAAACACGGACACTATTACAGCAGATGAAATCGTACCCATTCCCAGCGAAACCACTATTCTAGAAGGGAATATTCGCTATAACCTACAACTGAAAGATATATCTCTGGATAGCATCCATGAACTGATGGACCGGGTTGAAAACATTCAACAACCTGTCATCGACTGGCAGACTATGATGACTACCCCAAGTTGGTCAACACTGGGACTCTACCTCATTCTGATAGCAATAATCATCTGGAAGCTGTGGCAGTGGAGACAGCGACGACTACAATCAAAGAACGAGAGCCCCGAGAACACTAGCACCGAGGACGCTGCTGGAAGCTGCGGGACGCGCTTCTATCTTAAGGAGGGAGGAGTTAGGCAATCGCCCGATGCCCGTATTTGCTGA
Protein
MLALSPLPSQLIENSQKYEINKIETESDIDKELCENLKKIRTSHMNEEEKREITKICYQYRDIFYSENIPLSFTHTVKHELRLTDDTPIFVRSYRQAPQQRTEIQKQVDSLLKQGIIRESISPWSCPVHIVPKKPDASGKVKWRLVIDYRRLNDRIIEDKYPLPNINDILDRLGRAQYFTTIDLASGYHQLEMHPKDVEKTAFTTERGHYEFLRMPFGLKNAPSTFQRLMDHILRGIDNVFMYLDYVIIAATSLQNHNEKLKLVFQRFKMHNLKVQLDKSEFLQKHVNFLGHELTDQGLNPNKDKIKAVLNFPIPQTQKDIKAFLGLVGYYRKFIKDFAKLTKPLTACLKKNAKVEHTNEFLDAVDKCKQILTNAPILQYPDFDKPFILTTDASDFALGAVLSQGNVGSDKPVAYASRTLSDTEIRYSTIEKELLGIVWAIKYFRPYLYGRKFTIYTDHRPLTWLMSLKDPNSKLTRWKLKLAEYDYKVVYKKGKQNTNADALSRAKIFHNSIDSLAVNVDDNSDDNIINRIFENARRQAEVETDDPNNQDNERNNTDNDDQPYNNNDVEMTSIYPSQIDEETDTRSATTVDPDQLVSTNHTQPDNENNGIPIISDAIDRQLKQFYVRSTPGYTPRELLFGHTASRNPLELYYPKEFYQDYVLNHRKNAEAVQECIAAHVSKNKEQVIEKRNQAAETITFKTTSCSRALIAGAFVLYTAADLTLNPIDNTNGILLLKQGQILKQIDTFSLACVYNVSYLHETTLKLMSLYASTKAAEGNEELHRAYKDQIENSLHLIGKKLAFIAPHHRFRRGLINGLGSVVKTITGNLDYEDAIKFENELSNLRNSVHNINTSQKQTLFIAKHAVEEFSKQIKLLDENQKKIGSMLKNATLSNNVVISRLHFLDLYIQIYFSLQLLLDKLVILEDAMTFAQLEVMHPSIIAPHSLISEITAIQRLYQFRPVDRISIKNIHSIESSISVKAYSTNDALTFILDIPSIDENLYDLIHLYSIPDKQNLTIIPKSKYLALGTNEYSYLEEDCKKITQDVQLCTSLNTQPVENSEDCIVTLIKHESTNCTRARMNLKQGKIQRLEDNKWLIILKDEQILKSRCGRKSDYKKLSGIYIASITSDCQVEIFNRTLKTNTDTITADEIVPIPSETTILEGNIRYNLQLKDISLDSIHELMDRVENIQQPVIDWQTMMTTPSWSTLGLYLILIAIIIWKLWQWRQRRLQSKNESPENTSTEDAAGSCGTRFYLKEGGVRQSPDARIC

Summary

Uniprot
ProteinModelPortal
PDB
4OL8     E-value=9.82302e-77,     Score=735

Ontologies

GO

Topology

Length:
1269
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
21.1885
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00015
outside
1  -  1200
TMhelix
1201  -  1223
inside
1224  -  1269
 
 

Population Genetic Test Statistics

Pi
11.676493
Theta
17.209397
Tajima's D
-0.972153
CLR
16.811669
CSRT
0.139643017849108
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号