SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11778
Pre Gene Modal
BGIBMGA010315
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC106708942_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 2.061
 

Sequence

CDS
ATGGCTAACTATGAGAGAGATTTGTCATGCGACCCGGCTGACGCCCGGCGCTCGCAGGTACCCGGGCCTGCGAGTGATAAATTGGTTACCGATGGACGCGCAGGAGTAGGCGACCAGGCCCCTGTTGCTGATAATATTACTGGAAGCAGTTATTTTGAAAATATTGACGGAGGACCGCGTGGGTCGTCTTCCGTTAGAAAACGCTCACGCGACAATGCTCCAGTGGGAGATGGGTCGGTGGATCTGTCCTCAGATGAGGAAGGCTTGCTGCCCCCCAAGAAATTACCGACCACGAGGAGAGGTCGGCAGGCTTCGAGAGGAGTGACTGCTTCACGGCCGCGGAGGAACGCACAGGGTAGGTTCGTGTGCTCCAATACTCCGGCTGCCAGCAAAGCAGATAGTGACATGGGGGTCACTACCGAGGACCCTGGTGGCGAGAGCTGTGCCTCGCTAGGGAGCTCAAAGGCGGAGATCAACGCCGCCCGAAGAGAGCAGCGCAAAGCTGTCGCGGCCGACGAAGTGTCGGAAATGGCCCGACGCGCACGCGAGCGACGCGCTACTCTAGCGGCGGAAGGGGGGGAACCATCTGCGGTGGCCCTAAGTCAGCTTGCCTTGGACGGGGTGGACTTAGTCCTGAAGGTTGCCACCAAATCCGGCAGCCTGAAGGGCACGTTTACCCGCGGTCTGAAAGAAGCTGCCGCGGACATTAAGGAGGCGATTGGCATCCTCCTCAACAGGACGGCCTCTGACGAGGTTGCGAAGTTGCAGGAGGAAAACAGCCGTCTCCGAAATGATATGGAGGACCTCCGGCGACGAGTCACTGCGTTGAGCGAGCAGCAGCAGCGGCGTACGTCCACTGATGCCGCATCGGTAGTGACCCCGGCTCCCGCACCGAGACCGACAAGCACTCATACCGACGACGAGGTCGAGCGCATTGTCCGGCTCTGTATGCTCCAGTGCGGGAGCATGGTCAATGCTCGTATGGAGGCAATTTCTCGGCGCCTCCCTGCGGAAATCCTCCGTCCGCCACTAGCGGCCGATACACGGCGGAGGGCTGAGGAGCCGCCGAGACCTAAGCCTAGGGAGGGGAAGCCCGCGGAGGGTGTCAAAAAGCCCGTCGAGGGAGCCCCATCGAGCGATCAGCCCACGACTGCTGGGTCTAAGGGTGAGACCTGGGTTACAGTCGTGGGCCGCAAGAAGGCACGCAGGGTCGCCAAGGCGGCCTCAGCAGCAACGCATGCCCCCGGCCAAACCGCAAAGGCGGTTGCGCAGCCTGCGCGGCGGGCTGCCAAAGGCGGTCGCAAAGGACCGGAGATACGTGCTCCGCGTTCCGAAGCTGTGACGCTCACGCTACAGCCCGGAGCTGCGGAGCGCGGCGTAACGTACCAGTCGGTCATCGCCGAAGCAAAGGCCAAGATCAAATTATCAGATCTTGGTCTTCAGGCCGTCACCCACAGGCAGGCTGCCACGGGTGCACGGTTGTTCGAGGTGGCTGGTACTACGAGTGGCAGTGCCGAAAAGGCGGACGCTCTGGCCGCCAAGATGAGGGAGGTCCTCAGCCCCGAGGACGTCCGGGTCTCCAGGCCAATGAAAACCGCAGAGGTGCGGATTGCTGGACTGGATGACTCCGTGACCTCTGAGGAGGTGGTAGCGGCCGTTGCCCGAAGTGGAGAGTGTCCATCGGACAAGGTGCGGGCCGGCGATATACGCACCGATGCCACCGGACTCGGCGTGGTCTGGGTTCGGTGCCCTGTAGCGTCGGCGAAAAAGATCGCCTTAAGCGGCAGATTGCTGGTTGGCTGGGTTGCAGCGAGGGTGAAACTTCTACAGCCCCGGGCTTTGCGGTGTTTCCGGTGCCTGGATAAGGGGCACGTCCGGGCAAAGTGCACCGCTGAAGTTGACCGCAGTGACCTTTGTTATCGCTGCGGTCAGCCCGGCCACAAGGCGGCTCAGTGTTCCGCGGCGCTCAACTGCAGCTTGTGTTCAGCTGCAGGGAAGCCAGCGGGACACAGGCTGGGTGGAGGAGCCTGTGGCGCACCAGCCAGCAAGGCCAAGAAGAAGAAGAGGAACTCAAAACCTACCGGGGAAACCTCGCCACCCCCGCAGGCTAGTAGCTCCGGCAATATCAATCACTGTGCCAGAGCTCAGGATATTTTACTCCAGAGCATGGCAGAGTGGTCGATCCACGTGGCTGCGGTCGCCGAACCGTACTTTGTCCCCGCCCGTGACAACTGGCTGGGGAGCATTGACGGCTTGGTGGCCATTATCGGCCAGACTCTGATCAACCCGTCTCGGGGCCGCGGCTGGGTTGCTGCGGTCTCGGACGGTATCGGCATTGTAGGGGCGTATTTTTCTCCCAACAAGAGTCTCGCCGACTTTGAGGGGTTCCTCGTCGAGTTGGGCGCCGTCGTAGGCCGCTATCACCCTCGTCCCGTTCTGGTGCTCGGGGATCTCAACGCCAAGTCATCGGCGTGGGGATCTCCGGTCACTGACCATCGGGGCGAGGTGCTAGAAGAGTGGGCGGTGACAACTGGTCTGGTCGTCCTGAATCGGGGTTCGGAATACACGTGCGTGCGGCAGCGGGGCGGCTCGATAGTGGACGTCTCGTTTGCTAGCCCCTCTGTCGCCAGCCGAGTCCGCGACTGGCGTGTCGCCGTGGAGGTGGAGACGCTGTCGGACCATCGGTATATCCGGTTCGACGTCTCTGCCCAGACCGCGAGCGGCCGCCAGCCAACCGCCCCGATTAACGACGGCCCACGCTGGGCACTTAAGCGCATCGACGAGGAGCTACTCGAGGAAGCTGCCTTAGTCCAGTCCTGGATTTGGGAGTCGACAATGAACAGTCCCGTCGACGTCGAAGCGGTGGCGCTGTGGTTTCGAGGGGCGATGACGCAGATCTGCGACGCGTCCATGCCCCGTGTCCACCAACAGTCCGCAAGGCGCCAGGTGTACTGGTGGACCGACGAGATCGCACGGCTGCGCGTTGAGTGCGTCGCGGCTCGCCGCCGGTACACGCGATACCGGAGACGACGTCGACGGGATTCCGTCGAGGAAGACGCGCTGTATGAGGCGTACCGCGCGTCTAAGGAGACTCTGTGGCTGGCCATCGGCGACTCTAAGTCGCGTGCCAGGGAGGAGCTGCTGGGGTCCCTAGATCGGGATCCGTGGGGGCGCCCCTACCGTTGGGTACGGGGCAAGTTGCGTGCCTGGGCGCCTCCACTGGCGCAAAGCATGCAACCCCAGTTGCTAGAAGCGGTTGTATCGGCCCTCTTCCCTGAGCGAGCGGAATACGTTTCCCCGGCGATGGCTTCACCCTCAGCCACAGACTCTCGAGAAGAGGAAAGCACCGATGTCCCCGAGGTGACGCAAGCAGAAATGAGAGCGGCCGTGTCGCGACTCCGGTCTAAGAACACGGCCCCGGGACCCGACGGAGTTCCTGGTCGAGCACTCGTCCTGGCTCTGAAGGAGCTAGAGCCCCAGCTGAGGGGGCTCTTTACGGCATGTCTCGAGCAGGGTCAGTTTCCTAGTGTATGGAAGGAGGGGAAGCTGGTCCTGCTCAGGAAGGAGGGGCGCCCCGCGGACTCGCCGTCCGCGTATCGGCCCATAGTGCTGCTCGATGAGGCGGGCAAACTTTTTGAGCGCATTATCGCAGATCGCCTCGTCAGCCACTTGTGCAGGGAGGGGCCGGACCTGGATGACAACCAATTTGGTTTTCGTCGGGGGCGCTCCACCATAGACGCCATCATGCGCGTGAGGGCCCTGGCGGAGGAGACGGTGTCCCGGGGTGGGGTGGTACTGGCGGTGTCTTTAGACATCTCCAACGCTTTCAACACCCTACCCTGGAGTTGTATTCGGGAGGCTCTGAAATACCATCGCGTGCCTCCCTACCTCCGCCGCACGGTAGGGGCTTATCTGGAGGGTAGATGCGTCACTTATCGGGGACGTGACGGTGCCGGTCGGCACCTCATGTCGTGCGGTGTTCCACAGGGATCGGTCTTGGGACCGCTCCTGTGGAACATCGGCTACGACTGGGTGCTGAGAGGCGAGCTCCCGTCGGGCGCCAACTTGACGTGTTATGCGGACGACACGCTTGTCACTGCCCGGGGGAGCTCGCACAGGGAAGCGACGTTGATAGCCGCGGCTGCGGTGTCACTGGTGGTGAACCGCATCCGGCGCCTGGGCCTGGAGGTGGCCCTAAACAAGTCGGAGGCTATGGTGTTTCATGGCCCCCGACGTGCGCCGGCGCCGGGATCACACATCGTGCCGATGGGAATTCGGGCCCCACTTCCGGCGGCTGGTGCCCAAGCTGATGGGTGCAGCGGGCGCGCTTTCAACGTTGCTTCCCAATTTGGGGGGCCCGAGCGCCGCCTGTAG
Protein
MANYERDLSCDPADARRSQVPGPASDKLVTDGRAGVGDQAPVADNITGSSYFENIDGGPRGSSSVRKRSRDNAPVGDGSVDLSSDEEGLLPPKKLPTTRRGRQASRGVTASRPRRNAQGRFVCSNTPAASKADSDMGVTTEDPGGESCASLGSSKAEINAARREQRKAVAADEVSEMARRARERRATLAAEGGEPSAVALSQLALDGVDLVLKVATKSGSLKGTFTRGLKEAAADIKEAIGILLNRTASDEVAKLQEENSRLRNDMEDLRRRVTALSEQQQRRTSTDAASVVTPAPAPRPTSTHTDDEVERIVRLCMLQCGSMVNARMEAISRRLPAEILRPPLAADTRRRAEEPPRPKPREGKPAEGVKKPVEGAPSSDQPTTAGSKGETWVTVVGRKKARRVAKAASAATHAPGQTAKAVAQPARRAAKGGRKGPEIRAPRSEAVTLTLQPGAAERGVTYQSVIAEAKAKIKLSDLGLQAVTHRQAATGARLFEVAGTTSGSAEKADALAAKMREVLSPEDVRVSRPMKTAEVRIAGLDDSVTSEEVVAAVARSGECPSDKVRAGDIRTDATGLGVVWVRCPVASAKKIALSGRLLVGWVAARVKLLQPRALRCFRCLDKGHVRAKCTAEVDRSDLCYRCGQPGHKAAQCSAALNCSLCSAAGKPAGHRLGGGACGAPASKAKKKKRNSKPTGETSPPPQASSSGNINHCARAQDILLQSMAEWSIHVAAVAEPYFVPARDNWLGSIDGLVAIIGQTLINPSRGRGWVAAVSDGIGIVGAYFSPNKSLADFEGFLVELGAVVGRYHPRPVLVLGDLNAKSSAWGSPVTDHRGEVLEEWAVTTGLVVLNRGSEYTCVRQRGGSIVDVSFASPSVASRVRDWRVAVEVETLSDHRYIRFDVSAQTASGRQPTAPINDGPRWALKRIDEELLEEAALVQSWIWESTMNSPVDVEAVALWFRGAMTQICDASMPRVHQQSARRQVYWWTDEIARLRVECVAARRRYTRYRRRRRRDSVEEDALYEAYRASKETLWLAIGDSKSRAREELLGSLDRDPWGRPYRWVRGKLRAWAPPLAQSMQPQLLEAVVSALFPERAEYVSPAMASPSATDSREEESTDVPEVTQAEMRAAVSRLRSKNTAPGPDGVPGRALVLALKELEPQLRGLFTACLEQGQFPSVWKEGKLVLLRKEGRPADSPSAYRPIVLLDEAGKLFERIIADRLVSHLCREGPDLDDNQFGFRRGRSTIDAIMRVRALAEETVSRGGVVLAVSLDISNAFNTLPWSCIREALKYHRVPPYLRRTVGAYLEGRCVTYRGRDGAGRHLMSCGVPQGSVLGPLLWNIGYDWVLRGELPSGANLTCYADDTLVTARGSSHREATLIAAAAVSLVVNRIRRLGLEVALNKSEAMVFHGPRRAPAPGSHIVPMGIRAPLPAAGAQADGCSGRAFNVASQFGGPERRL

Summary

Uniprot
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR001878   Znf_CCHC       
IPR000477   RT_dom       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal
PDB
1WDU     E-value=5.98002e-09,     Score=151

Ontologies

Topology

Length:
1457
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01528
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00004
outside
1  -  1457
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
2.282495
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号