SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11777
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.955
 

Sequence

CDS
ATGGCACTATACGGCGCTCCCGTATGGTGCCACGCCCTGACCCGCGAGAACGTCGCCGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATTCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACAGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAGGGCGCCCCGGCGAAGGAGTAGTTCGAGCGCGGAGGCTCCAATCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGTACCGTCGAGGCGGTCCGTCCGGTCCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTAACGCAGATGCTTACCGGCCATGGTTGTTTCGGCCGGTACTTGCACAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATATCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MALYGAPVWCHALTRENVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPGEGVVRARRLQSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLHKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

EMBL
AB126050    BAD86650.1    AB090825    BAC57926.1    KZ150386    PZC71062.1    + More
KZ150308    PZC71477.1    KZ149950    PZC76665.1    AB078935    BAC06462.1    AB078931    BAC06456.1    AB078930    BAC06454.1    AB078929    BAC06452.1    LBMM01009501    KMQ88083.1    RSAL01000481    RVE41577.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    ODYU01009945    SOQ54696.1    LBMM01006538    KMQ90523.1    LBMM01008861    KMQ88580.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    D85594    BAA19776.1    KQ460685    KPJ12887.1    LBMM01014132    KMQ85305.1    QOIP01000009    RLU18544.1    LBMM01009494    KMQ88097.1    LBMM01006909    KMQ90209.1    GL450953    EFN80213.1    LBMM01006954    KMQ90166.1    LBMM01003679    KMQ93242.1    RSAL01003504    RVE40273.1    QOIP01000010    RLU18098.1    QOIP01000031    RLU14697.1    LBMM01006110    KMQ90925.1    LBMM01006671    KMQ90407.1    LBMM01008682    KMQ88705.1    LBMM01024024    KMQ82631.1    LBMM01019838    KMQ83439.1    LBMM01005634    KMQ91349.1    LBMM01019839    KMQ83438.1    LBMM01006725    KMQ90373.1    LBMM01005733    KMQ91252.1    LBMM01004272    KMQ92618.1    LBMM01006657    KMQ90417.1    LBMM01004505    KMQ92346.1    LBMM01008349    KMQ88951.1    LBMM01007036    KMQ90099.1    LBMM01005216    KMQ91703.1    LBMM01015018    KMQ84954.1    LBMM01015025    KMQ84953.1    KQ414641    KOC66782.1    ABLF02006132    LBMM01006662    KMQ90413.1    ABLF02041886    LBMM01003245    KMQ93755.1    CH963857    KRF98317.1    LBMM01006063    KMQ90967.1    LBMM01004634    KMQ92224.1    GECU01032129    JAS75577.1    LBMM01011877    KMQ86578.1    LBMM01014909    KMQ85000.1    LBMM01012595    KMQ86127.1    GFXV01003903    MBW15708.1    LBMM01003988    KMQ92922.1    QOIP01000007    RLU20280.1    LBMM01007088    KMQ90053.1    GGMS01012210    MBY81413.1    LBMM01002052    KMQ95336.1    GGMR01011974    MBY24593.1    ABLF02026677    ABLF02032994    ABLF02059021    ABLF02064578    ABLF02023401    ABLF02029423    ABLF02060278    ABLF02016435    ABLF02016436    ABLF02064751    LBMM01007425    KMQ89740.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    ABLF02011183    ABLF02041884   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07776   zf-AD
PF00096   zf-C2H2
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF17919   RT_RNaseH_2
PF13843   DDE_Tnp_1_7
PF05699   Dimer_Tnp_hAT
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR041577   RT_RNaseH_2       
IPR029526   PGBD       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
SSF53098   SSF53098       
SSF140996   SSF140996       
Gene 3D
PDB
4XVM     E-value=0.0275059,     Score=85

Ontologies

Topology

Length:
262
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01418
Exp number, first 60 AAs:
0.01209
Total prob of N-in:
0.02296
outside
1  -  262
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
-0.101721
CLR
11.660445
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号