SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11769
Annotation
PREDICTED:_uncharacterized_protein_LOC103314804_[Tribolium_castaneum]
Location in the cell
PlasmaMembrane   Reliability : 2.447
 

Sequence

CDS
ATGTATGGTAACTCGTCGCTAGTAGTATCAAGCTCGGAGCACTCGCATGGTCGAACTCACGCTGGCGGCAACGCACGTTGTACGACACATCTCGCGCGTCCCGCGTATTCACCCGCGCTTCCCGCCGCTGCTGTCGCTGCCGCTCGCACAGACAGCTCCGCAGCTATCAACTCGGACGGCAACACAAATGACTTCACATTATGCTCGCTGTCTTCCGCTCGCTTACCTACAACTGTTTTGCTTGCGACCGCTCGAGTTGTAATGGTTGATACTTATGGCAAACCGCATCTTGTTCGCGCCCTTTTAGATAGCGCCTCACAGAGTAATTTTATTACTCGTGAATGTTGTCAACGCCTTGGATTAAAATATAGTAACCAGCCTACGTGCCCCGTAGTCAAGGGCATAGGGGGGTCTACTAAGGACATCCAAGGGTCCGTAAAAATTAAATTTGAATCACGTTTTAGCTCGAATGTTTCATTCGAAATATACTCGCTGGTTGTAGATAAAGTAACGGAGCAACTTCCGACTGTTTCTGTAGATACCTCGTTGTTAGCTAACTTTGATAGTTTGCCGTTAGCCGATGATACTTACGCCGTTCCAGGTGCCGTCGATATTTTGATTGGCGCTTCGATTTTCCCGCACCTCCTGCTGCCACGTAAGGTTCAAGGTCATTCGGCGAACCCCGCACCGCACGCTTTGGAAACTGTTCTCGGTTTTGTTATAGTTGGATCCGCACCCGCTCTTATAAATAGTTACTCGACCGTATCATACTGCTGCGCCGTCGAGCCGCCACTGGAGTCCACCGTTCGCCGCTTTTGGGAAATTGAAGAAGTAAATGTTCCGCTTGTTATGAGTCCTGATGATAAGACCGCTGAGGATATTTATTGTAGCACGACCACCCGCGATGAAAGTGGTCGTTATATTGTCACTCTCCCCTTTAAGGGTGATACCTCTTCGCTTGGTGATTCGCGCCTAATGGCCGAAAAACGCTTTTTTTGTTTAGAACGTAAGATGATGGCATCCCCGAAGTTGAAAAAGGCCTACGACGATGTCGTGAATGAATATGTAGATAAGGGTGTCATCTCACCTGCTCCCGCTGTACTTGATGAGACGCAAAATGGTCCCTCTTATGTCATCCCGCATCATGGTGTCATTAGGGAGGATAAACTCACCACAAAATTGCGTGTTGTTCTGGATGGCAGTGCTAAGACTAGTACTTCTGTTTCTCTAAACGACATCTTGTATTGTGGTAAAAATCTTCAAGGTAACTTGTTTGATATTATCGTCAATTTTCGTTTATTTGTTGTAGCACTATCTGCAGACATTAGACAAATGTTTCTTTGTATTGGCATTCGGGAATCTGATCGTAGATTTCAAAGATTTTTATATAGGTTTTCCCCACACGAACCATTAAAGGTTTACCAGTTTAACCGCGTTTGTTTCGGACTTAAGTCAAGTCCTTTTCACGCGCTTCGCACTGTGAAGCAGTTAGTTCTTGATGAGGGTGATTCCTACCCCAAGGCAAAAGCTACCATCAATACTGGTCTGTATATGGACGACTTTGCTTATAGTGTAGATAGCGAGCCTGAAGCCATCGAAACAGCTACTCAAGTGATAAGCCTAATGAAGACTGGGCAATTTGACCTTGTTAAGTGGACGAGCAACTCTCAACGTGTTTTGGACTGGATTCCGCCATCGCATCGTCTATCGACGGTTAAGGATTTTGATGTCAATGATACACATAAGATTCTCGGCTTGAGCTGGTCTCCCACATCCGATACATTCAGTCTCAAAATTAGTTCGACCCCGCCAACTTGTACCAAACGCACCATATTGTCTTGTGTCGCTCGCATATGGGACATTATGGGTTTTGTAGCACCTGTAGTGTTATACGCAAAGCTTCTTATTAAAGAGCTTTGGCTTTCTCAGTGTGACTGGGATGACATCGCACCGGACAACGTGGCCAGATTATGGGCTCGCTTTAGGGAAGAGCTTCCTTTGCTCGAACATATAGAAATCCCACGTCATGTAGGTATCTCTCGAGATAGTGTAGTCACAATAGTGGGGTTCGCAGATGCTAGTGAGAAGGCTTATGGAGGAGTGGTGTATTTTCACGTTTGCAATGGCGACAATATTACAGTTAGCCTTATTAGTGCGAAATCTAAAGTCTCCCCTCGAAAGGTCGTCTCTCTCGCGCGCCTTGAGCTTTGCGCTCTACTACTATTGACGCGGCTCATTGGTGCCATAGTCAAGGGTTGTAACAACCGCATCAATATTGATAGAATTGCTGGCTTTTCTGATTCAACCGTGGCTTTGTGTTGGGCTCATTCTTCTCCCCACCGTTGGGACACATTTGTTGCTAATAGAGTAGCAAAAATTCAGTCTGAATTATCACCTCAAAATCTATATCACGTCGCTGGAACAGACAATCCTGCCGATTGTCTTTCGCGGGGTTTAACCCCCGCTCAAATATTAGATCATCCACTCTGGTTTCATGGTCCATCATGGGTACGAGATGCACCCTGTGATTGGCCAGTTAAGCTTTTTAATCTCGCGACTGTCTCTGAACCGCCAGAAGAAAAACGACACACTCTTGTAACTTCTGCGCCAAGAGAAGACTCAGTTATATTATTGTTGGCTAGTCGTGTTTCGTCATGGTCAAAGTTGTTACGTTGCGTGGTATATGTTTGCCGCTTTGCTAAACTGTTACCACAGCAACAGTACATAGTCGCCTCTGACTTTTATAAGGCAGAGCTTATTGTTCTTCGTGAACTGCAACGAGCGCATTTCGTTTCAGAAATTAGCAGCCTAGAGGCCAATAAACCTTGCAGGCGTCCTTTTCAAAATTTGAAGCCTTTCTTACAGGATGGACTCATCCGAGTAGGTGGTCGTTTGAGTCAGTCCAACTTAGGATTTGATCAAAAACACCCCATAGTTTTACCGCGTAAGGGCCACATCCTTGATTTACTGGTCGATTATTATCACAAACTTCACTGTCATGCTGGTCCCGATTTATTGATGTCAATACTTAGACAAAGATATTGGATACTTTCCGCACGTAATTTGATTCGCTCAAGGGTACATAAATGTGTGCCCTGTTATAGACTTCGTCCGCGTCCCATCGCACCTGAAATGACTGACCACCGTTCTTGTCGCGTTGTAGAAACCGCTAAACCTTTCGTGCATACTGGTACAGACTTTGCTGGACCCTTTAAGGTTACCATCTCACGTGGTCGGGGTATTCGTTCATCGAAAGCATATGTTTGTCTTTTCGTGTGTATGACTACTCGTGCTGTTCATATAGAACTAGCCAGTGATTTGAGCACGCATAGTTTCATGGCTGCTTTTAAAAGATTTTTATCGCGCCGAGGTCCTGTAGGTTGTATGTACTCAGATAACGGTACAAATTATGTGGGTGCCAAACGCAATATTTCGGAAGTTCACGCTTTTTTGAACTCTAAATACTACAAAACTGAATTCGCACATATGTTAGCAGAAAATCGCATTAAATGGCAGTTTAATACGCCCGCCGCAAGTCACTTCGGCGGAAATTGGGAAGCAAATATAAAAAGCCTTAAATCCCATCTTTATAGAGTTGTATGGTTGCAGATTCTCACTTTCGAAGAGTTGAGTACCGTGCTCACTCAAATAGAAGCCGTGATGAACACACGTCCGCTATGTAGGACACTGTCTGGCGACCCAGCTGAGCCGTTAGCTTTGACTCCGGCTCACTTTTTGTCGTTGACGCCGCTTAAATATTTACCCGCTAGAGATATTGACGAAGACAGGCAGCATATTCTCTCGCGTCACTCTCTTTTAGATAAATTAGTTCAGTCATTTTGGAAACGTTGGAAAACAGACTACTTACATACGCTACAATCGCGCCAAAAATGGAACACTCCATCCAACCCAATCGTTGTTGGAAAAGTAGTAATTTTAATGACGGAAAACGCGCCCCCGCTACATTGGCCTTTAGGAGTAGTGGAGGAGGTTTTTCCTGGTTCAAATGGAGTGATTAGAACTGTACGCGTTAGGACCGCAACCGGATCGTATCTACGCCCGGTTATTCGCCTCTGCCCTTTACCTAATTCACAATAG
Protein
MYGNSSLVVSSSEHSHGRTHAGGNARCTTHLARPAYSPALPAAAVAAARTDSSAAINSDGNTNDFTLCSLSSARLPTTVLLATARVVMVDTYGKPHLVRALLDSASQSNFITRECCQRLGLKYSNQPTCPVVKGIGGSTKDIQGSVKIKFESRFSSNVSFEIYSLVVDKVTEQLPTVSVDTSLLANFDSLPLADDTYAVPGAVDILIGASIFPHLLLPRKVQGHSANPAPHALETVLGFVIVGSAPALINSYSTVSYCCAVEPPLESTVRRFWEIEEVNVPLVMSPDDKTAEDIYCSTTTRDESGRYIVTLPFKGDTSSLGDSRLMAEKRFFCLERKMMASPKLKKAYDDVVNEYVDKGVISPAPAVLDETQNGPSYVIPHHGVIREDKLTTKLRVVLDGSAKTSTSVSLNDILYCGKNLQGNLFDIIVNFRLFVVALSADIRQMFLCIGIRESDRRFQRFLYRFSPHEPLKVYQFNRVCFGLKSSPFHALRTVKQLVLDEGDSYPKAKATINTGLYMDDFAYSVDSEPEAIETATQVISLMKTGQFDLVKWTSNSQRVLDWIPPSHRLSTVKDFDVNDTHKILGLSWSPTSDTFSLKISSTPPTCTKRTILSCVARIWDIMGFVAPVVLYAKLLIKELWLSQCDWDDIAPDNVARLWARFREELPLLEHIEIPRHVGISRDSVVTIVGFADASEKAYGGVVYFHVCNGDNITVSLISAKSKVSPRKVVSLARLELCALLLLTRLIGAIVKGCNNRINIDRIAGFSDSTVALCWAHSSPHRWDTFVANRVAKIQSELSPQNLYHVAGTDNPADCLSRGLTPAQILDHPLWFHGPSWVRDAPCDWPVKLFNLATVSEPPEEKRHTLVTSAPREDSVILLLASRVSSWSKLLRCVVYVCRFAKLLPQQQYIVASDFYKAELIVLRELQRAHFVSEISSLEANKPCRRPFQNLKPFLQDGLIRVGGRLSQSNLGFDQKHPIVLPRKGHILDLLVDYYHKLHCHAGPDLLMSILRQRYWILSARNLIRSRVHKCVPCYRLRPRPIAPEMTDHRSCRVVETAKPFVHTGTDFAGPFKVTISRGRGIRSSKAYVCLFVCMTTRAVHIELASDLSTHSFMAAFKRFLSRRGPVGCMYSDNGTNYVGAKRNISEVHAFLNSKYYKTEFAHMLAENRIKWQFNTPAASHFGGNWEANIKSLKSHLYRVVWLQILTFEELSTVLTQIEAVMNTRPLCRTLSGDPAEPLALTPAHFLSLTPLKYLPARDIDEDRQHILSRHSLLDKLVQSFWKRWKTDYLHTLQSRQKWNTPSNPIVVGKVVILMTENAPPLHWPLGVVEEVFPGSNGVIRTVRVRTATGSYLRPVIRLCPLPNSQ

Summary

EMBL
GBBI01004276    JAC14436.1    GEZM01054789    JAV73399.1    GEZM01054765    JAV73413.1    + More
GEZM01085145    GEZM01085143    JAV60187.1    ABLF02008594    ABLF02006304    ABLF02036268    ABLF02030854    ABLF02067347    GALX01004947    JAB63519.1    GGMR01017890    MBY30509.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    ABLF02030698    ABLF02030705    ABLF02030709    ABLF02036131    ABLF02041527    ABLF02064049    GGMR01002421    MBY15040.1    GGMS01010524    MBY79727.1    GEBQ01015458    JAT24519.1    GEBQ01000825    JAT39152.1    LBMM01009202    KMQ88311.1    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    ABLF02041863    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    LNIX01000007    OXA51795.1    LNIX01000069    OXA36894.1    GBHO01027036    GBHO01010996    GBHO01010995    GBHO01010993    GBHO01010991    JAG16568.1    JAG32608.1    JAG32609.1    JAG32611.1    JAG32613.1    GDHC01006469    JAQ12160.1    ABLF02035780    LNIX01000016    OXA46198.1    ABLF02005684    LNIX01000002    OXA60848.1    GBBI01004211    JAC14501.1    GFTR01008866    JAW07560.1    LBMM01008464    KMQ88855.1    OXA59522.1    LBMM01009863    KMQ87831.1    JXUM01113346    KQ565681    KXJ70776.1    LBMM01009645    KMQ87967.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    LBMM01009964    KMQ87756.1    GDHC01014057    JAQ04572.1    LBMM01009888    KMQ87813.1    KK114194    KFM61875.1    GBRD01007977    JAG57844.1    LBMM01009551    KMQ88039.1    GGMR01010723    MBY23342.1    GFTR01008874    JAW07552.1    GBHO01031928    GBHO01031926    JAG11676.1    JAG11678.1    GGMR01016460    MBY29079.1    GBHO01030122    GBHO01030121    GBHO01030120    GBHO01030116    JAG13482.1    JAG13483.1    JAG13484.1    JAG13488.1    GGMR01013370    MBY25989.1    GBBI01004410    JAC14302.1    GGMR01010750    MBY23369.1    GBBI01004408    JAC14304.1    GEZM01066272    JAV68024.1    GGMS01014951    MBY84154.1    GGMR01018506    MBY31125.1    GBHO01009080    JAG34524.1    ABLF02008636    ABLF02065931    ABLF02039606    LBMM01009688    KMQ87939.1    LBMM01010417    KMQ87475.1    GGMR01018294    MBY30913.1    ABLF02025193    LBMM01009898    KMQ87805.1    LBMM01009746    KMQ87900.1    EF426679    ABP48078.1    GBHO01044643    JAF98960.1    GBHO01044316    JAF99287.1    ABLF02042806    GGMR01002024    MBY14643.1    GEZM01060254    JAV71154.1    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    GBHO01007061    JAG36543.1    GBHO01007689    JAG35915.1    GDHC01016727    JAQ01902.1    ABLF02022040    ABLF02056888    GDHC01011948    JAQ06681.1    NWSH01000070    PCG79985.1    GDHC01014268    JAQ04361.1    ABLF02041505   
Pfam
PF00078   RVT_1        + More
PF03564   DUF1759
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF17921   Integrase_H2C2
PF05585   DUF1758
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF00230   MIP
PF12259   Baculo_F
Interpro
IPR041588   Integrase_H2C2        + More
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR000477   RT_dom       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001584   Integrase_cat-core       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR001995   Peptidase_A2_cat       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR041577   RT_RNaseH_2       
IPR036875   Znf_CCHC_sf       
IPR000727   T_SNARE_dom       
IPR000425   MIP       
IPR023271   Aquaporin-like       
IPR022048   Envelope_fusion-like       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
SSF81338   SSF81338       
Gene 3D

Ontologies

Topology

Length:
1365
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.19884
Exp number, first 60 AAs:
0.00077
Total prob of N-in:
0.00151
outside
1  -  1365
 
 

Population Genetic Test Statistics

Pi
4.458008
Theta
2.721166
Tajima's D
-1.516778
CLR
43.358369
CSRT
0.0502974851257437
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号