SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11760
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.474
 

Sequence

CDS
ATGGTGACCAGGGGCCCCGGGATCGTCGCGGTACAGTTAGAAAATATCGTCGTGATCGGGGTGTACTTTTCTCCGAATCGGCCTACCGTCGAGTTCGAGCGGTTCCTGGACGGGCTAGAGGTGATCGCTCGTCACCTCGCTCCCCGTTCAGTGATACTGGCGGGGGACTTCAATGCGAAGTCTGTCGCTTGGGGTTCCCCATTCACGGACGCTCGTGGTAGGCTGCTGGAGGAGTGGGCGGTCGCGGTCGGTCTCTGTATCGTTAATAGGGGCTCGATCGCGACTTGCGTGCGGTGGACGGGCGAGTCTATCGTGGACTTGACGTTCGCGAGCTCGCCCGTCGCGCGGCGCATCCTCGGCTGGAGAGTGGTGGTGGGGGCGGAATCGTTGTCCGATCACCGGTATATCCGGTACGATCTTTCTGCCCCTGCGCCGACGCCGGCTGCAGGTGCCCGCGGGGTTGACCCCCCGCAGAGTGCATCCCGGTCATTCCCTAGGTGGGCACTGAAGCTCCTGAACAGGGAGCTCCTGGTGGAGGCCTCTATGGTGGCGGCGTGGGCGCCCAAGCGCCCACAACCTGTCGATGTGGAAACCGAGGCCGAATGGTTCCGGGGCGCGATGCACCGCATATGTGATGCCTCGATGCCCCGGGTCGGCTCTCGGCACTCTGGACGGCGACAGTCGCCCTGGTGGTCGCCCGAAATTGCAAGACTGCGTGCGGTCTCCATTCGGGCGAGCCGCCGGTGCACTAGACACCGCCGTCGCCGCCGCCTGCGGCGCGACGAGCCCGTCGCGTTCGCGGAGGAGGAAGCTCGGCTGCACCGCGAATATCGCGCTGCGAAGGACGCCCTGCGGCTGGCCATCAGGCGGGCCAAGGAGCAGAACATGGAGAGACTCTTGGAGGCGCTCGAAGCGGATCCGTGGGGGAGCCCATACAAATTGGTACGCTGCAAGTTGCGCCCGTGGGCCCCCTCTATGACTGAGCGTCTCCAGCCCCAGCAGCTGCGGGACATCGTTTCGGCGTTGTTCCCGCAGGAGCGGGAGGGTTTTGTCCCTCCCGCTATGGGCGGGCCGTCTGACACCGTCGACGGCCAAGCTCCTGCTGAGGTGCCTCGTATTACCGAGGCAGAGCTCCGGGTGGCCGTTGTCAAGATGACTGCGAAAGACACGGCCCCCGGCCCGGACGGAGTCCACGGCCGGGTATTGGCCTTGGCCCTCGGTGCCCTGGGGGACCGGCTCCTTGAGCTATATAATGGCTGCTTGGAGTCGGGACGGTTTCCGTCGCTCTGGCGGACGGGTAGACTTGTGTTGTTGAGGAAGGAGGGGCGCCCGGTGGATACAGCCGCCGGGTATCGTCCTATCGTGCTGCTGGACGAGGCGGGAAAATTGCTGGAACGTATTCTGGCTGCCCGCATCGTTCGGCACCTGGTCGGGGTGGGGCCTGACCTGTCGGCGGAGCAGTACGGCTTCCGGGAGGGCCGTTCGACCGTGGATGCAATTCTTCGCGTGCGGTCCCTCTCGGACGAGGCCGTTTCTCGGGGTGGGGTGGCGCTGGCGGTGTCTCTTGACATCGCCAACGCATTTAACACTCTGCCCTGGACCGTGATAGGGGGGGCACTGGAGAGGCATGGAGTGCCCCTCTACCTCCGCCGGCTGGTTGGGTCCTATTTGGGGGCCAGGTCGGTCGTATGTACCGGGTACGGTGGGACCCTTCATCGTTTTCCGGCCGTGCGTGGTGTTCCGCAGGGGTCGGTTCTCGGCCCCCTCTTGTGGAATATCGGGTACGACTGGGTGCTGAGGGGCGCCCTCCTCCCGGGCCTCCGCGTTATTTGTTACGCGGACGACACGTTGGTCGTGGCCCGGGGGGATGATTTTAGGGAGTCTGCCCGTCTCGCCACAGCGGGAGTGGCCCTCGTCGTCGGAAGGATAAGGAGGCTGGGTCTCGACGTGGCGCTCAATAAATCCGAGGCTCTGTGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCGTGTTGGACAGCCGGTGGGCCTTTCGTGCTCACTTTGCGGAGCTGGTCCCCCGATTGATGGGGACGGCCGGTTCTTTGAGCCGGCTGCTCCCGAATATTGGGGACCGGATCAGGTTGTGCGCCGTCTCTACGCGGGGGTGGTGCGATCGATGGCCCTGTACGGTGCACCTGTGTGGGCTGAGCCGCGCAACCGGGCCACTATGGCTCGGTTCTTGCGCCGGCCGCAGCGCACCGTTGCCATCAGGGTCATCCGCGGATATCGCACCGTCTCCTTCGAGGCGGCGTGTGTTTTGGCGGGGACGCCGCCATGGGAGCTGGAGGCGGAGTCGCTCGCTGCCGACTATCGGTGGCGCAGCGAGCTTCGTGCTCGGGGCGTGGCGCGTGTCCCCGAGAGTGAGCTGCGGGCGCGGAAGGCCCATTCTCGGCGGTCCGTGCTCGAGTCGTGGTCGAGGCGATTGGCCAACCCCACGTGGGGGCTACGGACCGTCGAGGCGGTTTACCCGGTCTTTGATGACTGGGTGAATCGTGGCGAGGGACGTCTCACCTTTCGTCTGGTGCAGGTGCTGACCGGGCACGGATGCTTCGGGAAGTACCTGCGCCGGATAGGGGCTGAGCCGACGACGAGGTGTCACCATTGTGGACACGACCTGGACACGGCGGAGCATACGCTCGCTGTCTGCCCCGCTTGGGAGGTGCAGCGCCGTGTCCTGGTCGCAAAGATAGGACCTGACTTGTCGCTGCCTGGCGTCGTGGCGTCGATGCTTGGCAGCGATGAGTCATGGAAGGCTATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGAGTGAGGGAAAGCTCTCCTCACTACGCAGAAACCCGCCGCCGCCGAGCAGGGGGTCGGGACCGGGGTCGTATCCGTGACCTGGCCCCCTAA
Protein
MVTRGPGIVAVQLENIVVIGVYFSPNRPTVEFERFLDGLEVIARHLAPRSVILAGDFNAKSVAWGSPFTDARGRLLEEWAVAVGLCIVNRGSIATCVRWTGESIVDLTFASSPVARRILGWRVVVGAESLSDHRYIRYDLSAPAPTPAAGARGVDPPQSASRSFPRWALKLLNRELLVEASMVAAWAPKRPQPVDVETEAEWFRGAMHRICDASMPRVGSRHSGRRQSPWWSPEIARLRAVSIRASRRCTRHRRRRRLRRDEPVAFAEEEARLHREYRAAKDALRLAIRRAKEQNMERLLEALEADPWGSPYKLVRCKLRPWAPSMTERLQPQQLRDIVSALFPQEREGFVPPAMGGPSDTVDGQAPAEVPRITEAELRVAVVKMTAKDTAPGPDGVHGRVLALALGALGDRLLELYNGCLESGRFPSLWRTGRLVLLRKEGRPVDTAAGYRPIVLLDEAGKLLERILAARIVRHLVGVGPDLSAEQYGFREGRSTVDAILRVRSLSDEAVSRGGVALAVSLDIANAFNTLPWTVIGGALERHGVPLYLRRLVGSYLGARSVVCTGYGGTLHRFPAVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLRVICYADDTLVVARGDDFRESARLATAGVALVVGRIRRLGLDVALNKSEALWGRGAVEVPRPRVGQPVGLSCSLCGAGPPIDGDGRFFEPAAPEYWGPDQVVRRLYAGVVRSMALYGAPVWAEPRNRATMARFLRRPQRTVAIRVIRGYRTVSFEAACVLAGTPPWELEAESLAADYRWRSELRARGVARVPESELRARKAHSRRSVLESWSRRLANPTWGLRTVEAVYPVFDDWVNRGEGRLTFRLVQVLTGHGCFGKYLRRIGAEPTTRCHHCGHDLDTAEHTLAVCPAWEVQRRVLVAKIGPDLSLPGVVASMLGSDESWKAMLDFCECTISQKEAAGRVRESSPHYAETRRRRAGGRDRGRIRDLAP

Summary

EMBL
AB090825    BAC57926.1    AB078931    BAC06456.1    AB078929    BAC06452.1    + More
AB078930    BAC06454.1    AB078935    BAC06462.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    AB078936    BAC06464.1    LBMM01006671    KMQ90407.1    LBMM01006954    KMQ90166.1    RSAL01003504    RVE40273.1    LBMM01004272    KMQ92618.1    LBMM01008448    KMQ88867.1    LBMM01007036    KMQ90099.1    LBMM01015025    KMQ84953.1    LBMM01006657    KMQ90417.1    LBMM01004634    KMQ92224.1    LBMM01002052    KMQ95336.1    LBMM01012412    KMQ86235.1    LBMM01014122    KMQ85315.1    LBMM01008278    KMQ89009.1    LBMM01003988    KMQ92922.1    LBMM01008422    KMQ88894.1    LBMM01005474    KMQ91485.1    LBMM01004262    KMQ92649.1    GGMR01015159    MBY27778.1    LBMM01006977    KMQ90149.1    LBMM01007425    KMQ89740.1    LBMM01015285    KMQ84870.1    GFXV01002090    MBW13895.1    LBMM01002480    KMQ94776.1    GGMR01006838    MBY19457.1    ABLF02011238    LBMM01005465    KMQ91492.1    ABLF02023257    GGMR01019493    MBY32112.1    LBMM01008445    KMQ88871.1    AB593325    BAK38646.1    ABLF02034925    LBMM01004505    KMQ92346.1    LBMM01015018    KMQ84954.1    ABLF02011183    ABLF02041884    ABLF02041886    ABLF02004854    ABLF02041317    LBMM01005948    KMQ91066.1    ABLF02018942    ABLF02041885    GGMR01012748    MBY25367.1    ABLF02018808    GGFJ01001439    MBW50580.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    ABLF02009073    ABLF02030702    ABLF02042963    GALA01001777    JAA93075.1    AB593321    BAK38639.1    LBMM01005733    KMQ91252.1    ABLF02014650    GAMC01020517    JAB86038.1    GAMC01020519    GAMC01020515    JAB86040.1    GGFJ01001369    MBW50510.1    LBMM01008226    KMQ89040.1    GGFJ01001370    MBW50511.1    GALA01000302    JAA94550.1    ABLF02041557    LBMM01009535    KMQ88053.1    GGMR01004600    MBY17219.1    KQ972691    KXZ75806.1    KQ971675    KYB24771.1    KQ972544    KXZ75869.1    ABLF02007989    KQ971309    EEZ99146.1    GALA01001776    JAA93076.1    GGFJ01001727    MBW50868.1    GGMR01000779    MBY13398.1    ABLF02018098    GGFJ01001453    MBW50594.1    GGFL01004044    MBW68222.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    GGFK01005660    MBW38981.1    AB593323    BAK38643.1    KU543682    AMS38369.1    GGFJ01001165    MBW50306.1    GGFJ01001454    MBW50595.1    GGFL01004046    MBW68224.1    KXZ75807.1    GGFJ01001164    MBW50305.1    GDHF01029467    GDHF01011533    JAI22847.1    JAI40781.1    ABLF02011927    GAKP01002292    JAC56660.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF00098   zf-CCHC
PF12017   Tnp_P_element
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR021896   Transposase_37       
IPR000663   Natr_peptide       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
1WDU     E-value=4.13787e-11,     Score=168

Ontologies

Topology

Length:
978
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.23656000000001
Exp number, first 60 AAs:
1.21235
Total prob of N-in:
0.06282
outside
1  -  978
 
 

Population Genetic Test Statistics

Pi
0.275054
Theta
0.577088
Tajima's D
0
CLR
16.972054
CSRT
0.462826858657067
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号