SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11756
Pre Gene Modal
BGIBMGA014357
Annotation
gag-pol_polyprotein?_partial_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.223
 

Sequence

CDS
ATGGATTCTACAATTTATGCAGCCAATGATGAAAAAATGAAAGCACAAGGTTCAGGTACTGTCCATGGAATGTCATGCGATTTACAAAAGACTTTATTTATACCAGACTTAGCACAAAACCTTTTGTCTGTAAATTGTGTTACCAACAATAATGGCTCTGTTGTGTTCACAAAGAATAAAGTGGAGATTTACAAAAATTCAAAATTAATTTTAACCGGCAAAAAAGAAAATGGCTTATACAGGGTGAATTTAGTACAAGACCTGAAAAATGAAAATAAATCCTTACTTACACAAGTAAACGGAACAGCATTGGAATGGCATGCAAAACTGGGACACCCAGATAAATCAGTACTAGAAACACTAACAAAAGTGGCAGACGGCATTAATATACAAGGACCAAAAGTATTACAAGAACAGTGTAAAATATGTGCTGAAGCAAAACAGTCAAGACTACCATTTAATACAATCAGAACTCGTGCTGAAAGACTACCAAGTCATGCCCTAAAAAACAAAACACCATATGAAATGTGGGTTGGAAAAAAGCCTAATATATCTAATATGCAAAAGTTTGGTTCTACTGTCTATGCAAAACAGTTACATCCAAATGTAAAGAAACTGGATCCTAGAAGCAAGAAACTGATAATGATTGGATACACTAATAATGGGTACAGACTGTGGAATGACAAGGAGAGAAAAATAGAGATATCAAGGGACATGGTGATAGTAAAAAGTGAAACTGAACAAAAGAAAGAAAACTATAAGAAAATAAATAATAATAAAAGTGAAAATGATGAAAAAGAGACAACAGAAAACCAGGAAGAGACAACAGAAAACCAGGAAAAGACTACAGAAAACCAGGAACAGATTACAGAAAAGCAGGAAGAGACAACAGAAGATACCAGAACAGAAGAAAATAAAAATGATGAGACTTTTGAAGATGTAGTTTCAGAAACTGAATCAGAAGACACACAAAGAGAAAGAAACAGACAGAATGAAGAAGATGGTTACCTAAGAAGAAGCAAGAGAATTAGACACATACCAATACATTTAAGAGACTACAGTTTACTTACTTACAGAGAGGCTGTAACATCTAAAGAGGGAGAAAACTGGGAGAAGGCCATAAATTCGGAGAAGGAATCCTTGGAAATCAATAATACCTGGGAAATAGTAGACAAGAAAGAGGCAAAAGATAGTAAAATACTTACAAACAAATGGGTATTCCGTGTGAAAGATAATGGCACTTATAAAGCTAGACTTGTTGTACGAGGATTTGAACAAAACAGTATTGACTACAATGAAATATACAGTCCAGTTGTCAGTCAGTTAACTTTAAAATCTTTATTTGCACTTGCTGCTTCTAAAGACTATAACATGATGACATTTGATGTTAAGACTGCATTTTTATATGGAGAGCTGGAAGAAAATGTGTATATGAATATACCGGATGGATATGAAAAACAACCTGGGAAATTTTGTCGATTAAAGAAATCCTTATATGGACTAAAACAAGCTCCTATTACATGGAACAAAAGATTTACAAAAGCAATGTTAAAACTTGGTTTAAAAGCTACTAAAACAGACCAGTTTGTATTTACAAATGAAGATAATACAATAATAATAGCAATCTATGTAGATGATGGACTTGCTTTGGCTAAAGAAAAGCAAACATTAAAAAACATTTTAAACTGCCTAGAAAAGGAATTTGAAATAAAAGTATACAATGATCCTACTACTTTTATTGGATTTGAAGTCAAGAAGACTGAGAAAGGTATAACACTGAAACAAGAAAGCTACATTGGAAACTTATTAAAGAAATTTAGTATGGAAGATTCTAAACCTGTTAAGACACCCTGCAATACAGAAAATAAAACAGAAACGCAAAACACAGATACTATAAATTTTCCATATAGAGAACTGATTGGAGGACTTCTATATGTATCTACAAGAACAAGGCCGGACATAAGTCAAGCTGTAAATGAAGCAAGCAGAAAAATAGAAAACCCTACAAAAGATGATGTGATAGCTGCAAAGAAAATACTAAAATATTTAAATGGAACAAGACAGAAAGGAATCATGTACAAGAAAGGAGGAGATATGTCAAAACTAAATGCATACTGTGATGCAGACTATGCCAATTGTAACAAGACAAGACGCAGTACAACCGGATTTGTGATAATGTTAGCAGAAGGACCTGTGTCTTGGTGTTCAAAACGACAACCAATCGTTGCATTATCATCAACTGAAGCAGAGTATATTGCAGCAGCTGATTGCTGTAAGGAATGCTTATATTTAAGGTCATTTTTAAAGGAGTTGATTGGTTCTGAAGTTGAAATTACATTAAATGTTGATAACCAAAGCGCTATTCAGCTGATCAAAACAGGAGAAGGTGTTAGTGGGTACATCCCTATTAAGAAGTGTGAGCTGTATGTAGCACGACACTAG
Protein
MDSTIYAANDEKMKAQGSGTVHGMSCDLQKTLFIPDLAQNLLSVNCVTNNNGSVVFTKNKVEIYKNSKLILTGKKENGLYRVNLVQDLKNENKSLLTQVNGTALEWHAKLGHPDKSVLETLTKVADGINIQGPKVLQEQCKICAEAKQSRLPFNTIRTRAERLPSHALKNKTPYEMWVGKKPNISNMQKFGSTVYAKQLHPNVKKLDPRSKKLIMIGYTNNGYRLWNDKERKIEISRDMVIVKSETEQKKENYKKINNNKSENDEKETTENQEETTENQEKTTENQEQITEKQEETTEDTRTEENKNDETFEDVVSETESEDTQRERNRQNEEDGYLRRSKRIRHIPIHLRDYSLLTYREAVTSKEGENWEKAINSEKESLEINNTWEIVDKKEAKDSKILTNKWVFRVKDNGTYKARLVVRGFEQNSIDYNEIYSPVVSQLTLKSLFALAASKDYNMMTFDVKTAFLYGELEENVYMNIPDGYEKQPGKFCRLKKSLYGLKQAPITWNKRFTKAMLKLGLKATKTDQFVFTNEDNTIIIAIYVDDGLALAKEKQTLKNILNCLEKEFEIKVYNDPTTFIGFEVKKTEKGITLKQESYIGNLLKKFSMEDSKPVKTPCNTENKTETQNTDTINFPYRELIGGLLYVSTRTRPDISQAVNEASRKIENPTKDDVIAAKKILKYLNGTRQKGIMYKKGGDMSKLNAYCDADYANCNKTRRSTTGFVIMLAEGPVSWCSKRQPIVALSSTEAEYIAAADCCKECLYLRSFLKELIGSEVEITLNVDNQSAIQLIKTGEGVSGYIPIKKCELYVARH

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
813
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00127
Exp number, first 60 AAs:
0.00052
Total prob of N-in:
0.00016
outside
1  -  813
 
 

Population Genetic Test Statistics

Pi
13.955644
Theta
25.903319
Tajima's D
-1.374714
CLR
2.998733
CSRT
0.0759962001899905
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号