SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11733
Pre Gene Modal
BGIBMGA004163
Annotation
PREDICTED:_peptidylprolyl_isomerase_domain_and_WD_repeat-containing_protein_1-like_[Amyelois_transitella]
Location in the cell
Cytoplasmic   Reliability : 2.205
 

Sequence

CDS
ATGTCCGCCGAGAAAAGAACAGCCGATGACGAAAAAGCTGCTGGAGAATGTGACGGTGATGATCCAGAAAACTGGATTGGACCAATGCCTTCAGAGGCGGTAAAACCCAAACAAAAAAAACGAAAAGTATTAGAATTTGAAACACTATACCTGGAGAATTTGCCTTCATCAGAAACATATGAAAGAAGTTTCATGCACAGGGATATTGTTACACACGTACTTGTCACAAAAACTGATTTTGTGGTAACAGCAAGTCAGGATGGTCATTTGAAATTTTGGAAGAAACAAGAAGAAGGTATAGAATTCGTAAAGCACTTCAGATGTCACTTAGCACCAATCTCCCATGTCGCAGCAAACAGCACCGGTACTTTACTCTGCACTGCATCACCAGAGAAGACAATAAAGGTGTTTGATGTTGTTAACTTTGATATGATTAACATGATATCAATAGATTTTGAGCCATATCGAGTGGAGTGGGTGCATTCCGCTGGTGACCCCATCTCAGCTTTAGCTGTCTCGGACAGAAACACAAATAAGATTCACGTGTACGACGGCACGCAAGCTTCGGGCACTCCGCTGCACACGTTCGAGACTCTGCACCAGACCGCGGTGGCGGTCATCAAGTATAACCCGGTCTTCGAAACTGCTGTCTCCGTCGATAAGGCCGGCATAGTCGAGTACTGGACGGGTCCGAAGCACGAATACAATTTCCCCAAGACGGTGAGGTTTCAGTCGAAGCTCGACACGGACCTGTACGACTTCGTGAAGAACAAGACTTGTCCGACGGCGCTGGACTTCTCGCCGGACGGCAGAAAGATGGCCTCGATAAGCCTCGACAGGAAGGTGCGAGTGTTCCACTTCCTGACCGGCAAACTGCACAAGGTGATCGACGAGAGCCTGCAGCGGTTCCAGGAGTTGCAGCATCAGACGCAGCAGCTGCCCAACATGGAGTTCGGGAGGAGGATGGCGACGGAGCGCGACCTGGAGAAGTCTGAGTGCGTGTCGCTGGGCAACGTGGCGTTCGACTGCAGCGGACACTTCGTGCTGTACGGCACGCTGCTGGGCGCCAAGCTCGTCAACCTGGCCACCAACCGCTGCGCCGCCACCTTCGCCAGGACGGAGAACCTCAGGCCGCTGCACCTCGCACTCTTCCAGGGCCGCCTCAACCAGCCCAAGGTGGCGTCGACCCTCGAAATGGAGGGCTCCGAGAACCCCGCGCTGCTGACCGTGAAGACGGACCCCACGCTGTTCTGCACGGCCTACAAGAAGAACAGGTTCTATCTGTTCTCCAAGCGCAGCCCCGACGACGTCAAGGGCCCGGACAACGACAGAGACATCTTCAACGAGAAGCCGTCCAAGGAGGATATCATCTCCGCCACCGAGGGCCAAGGAGTCCAGCGGATCTACGAGCAGGCGGTCATACACACGACGCTGGGCGACATCCACGTGCGGATCTTCGGGAAGGACGTCCCGAAGACGGCCGAGAACTTCTGCGTCCACGCCAGGAACGGCTACTACAACGGACACATCTTCCACCGGGTCATCAAGGGCTTCATGGTGCAGACCGGGGACCCCACAGGCACCGGCACGGGCGGGGAGAGCATCTGGGGCGGCGAGTTCGCGGACGAGTTCCGCGCGCACCTCAAGCACGACCGGCCCTACACGCTCAGCATGGCCAACGCCGGGCCCGACACCAACGGCAGCCAGTTCTTCATCACGCTGGCGCCCACGCCGTGGCTGGACAACAAGCACACGGTGTTCGGTCGCGTGACGCGCGGCATGGAGGTCGTGCAGAACATCGGCGCCGCCAAGACCAACCCCAAGACCGACAAGCCCTACGACGACATCAGGATCCTGTCGCTCTCCGTCAAGTGA
Protein
MSAEKRTADDEKAAGECDGDDPENWIGPMPSEAVKPKQKKRKVLEFETLYLENLPSSETYERSFMHRDIVTHVLVTKTDFVVTASQDGHLKFWKKQEEGIEFVKHFRCHLAPISHVAANSTGTLLCTASPEKTIKVFDVVNFDMINMISIDFEPYRVEWVHSAGDPISALAVSDRNTNKIHVYDGTQASGTPLHTFETLHQTAVAVIKYNPVFETAVSVDKAGIVEYWTGPKHEYNFPKTVRFQSKLDTDLYDFVKNKTCPTALDFSPDGRKMASISLDRKVRVFHFLTGKLHKVIDESLQRFQELQHQTQQLPNMEFGRRMATERDLEKSECVSLGNVAFDCSGHFVLYGTLLGAKLVNLATNRCAATFARTENLRPLHLALFQGRLNQPKVASTLEMEGSENPALLTVKTDPTLFCTAYKKNRFYLFSKRSPDDVKGPDNDRDIFNEKPSKEDIISATEGQGVQRIYEQAVIHTTLGDIHVRIFGKDVPKTAENFCVHARNGYYNGHIFHRVIKGFMVQTGDPTGTGTGGESIWGGEFADEFRAHLKHDRPYTLSMANAGPDTNGSQFFITLAPTPWLDNKHTVFGRVTRGMEVVQNIGAAKTNPKTDKPYDDIRILSLSVK

Summary

EMBL
BABH01028842    BABH01028843    ODYU01000451    SOQ35257.1    KZ150162    PZC72691.1    + More
NWSH01000119    PCG79366.1    GAIX01004546    JAA88014.1    PCG79368.1    KQ460949    KPJ10422.1    KQ459598    KPI94541.1    PCG79369.1    RSAL01000070    RVE49185.1    KK852552    KDR21487.1    KQ414843    KOC60327.1    KQ434786    KZC05212.1    GL762111    EFZ22116.1    KZ288392    PBC26344.1    KQ435695    KOX80855.1    KQ982630    KYQ53380.1    KQ980050    KYN18018.1    KQ976782    KYN08326.1    AXCN02002201    KQ981953    KYN32291.1    ADTU01010757    KK107039    QOIP01000006    EZA61879.1    RLU21706.1    GL888074    EGI67959.1    KQ976572    KYM80392.1    GL436710    EFN71628.1    APCN01000690    GL448039    EFN85461.1    AAAB01008944    EAA10133.4    JXUM01086237    KQ563553    KXJ73665.1    CH477381    EAT42209.1    ADMH02001090    ETN64138.1    GEDC01009102    JAS28196.1    GFDL01011005    JAV24040.1    AXCM01009205    KY809867    ATI09792.1    ATLV01010731    KE524607    KFB35663.1    GFDL01010898    JAV24147.1    DS231829    EDS30345.1    UFQS01000650    UFQT01000650    SSX05751.1    SSX26110.1    APGK01049760    KB741156    KB631941    ENN73622.1    ERL87373.1    GBYB01002612    GBYB01002613    GBYB01002615    GBYB01002616    JAG72379.1    JAG72380.1    JAG72382.1    JAG72383.1    GECU01030402    JAS77304.1    KQ971347    KYB26968.1    DS235281    EEB14342.1    CH477416    EAT41334.1    MRZV01000846    PIK43499.1    NEDP02004282    OWF46092.1    GAMC01011960    GAMC01011958    GAMC01011956    GAMC01011954    JAB94599.1    JH431795    AYCK01013843    GANP01003901    JAB80567.1    ABJB010781258    DS816156    EEC11417.1    AAPE02000814    KK122361    KFM82579.1    KE161240    EPQ02561.1    GECZ01024029    JAS45740.1    CP026246    AWP00663.1    AGTP01014029    GFFW01000680    JAV44108.1    JH000876    KE667815    EGW03514.1    ERE84802.1    AQIB01086597    AHZZ02029243    AQIA01059079    AQIA01059080    AQIA01059081    CM001281    EHH54293.1    JSUE03036116    JU333675    CM001258    AFE77430.1    EHH26534.1    RAZU01000096    RLQ73422.1    KB030673    ELK11393.1    CABD030104557    CABD030104558    ADFV01031059   
Proteomes
UP000005204    UP000218220    UP000053240    UP000053268    UP000283053    UP000027135    + More
UP000053825    UP000002358    UP000076502    UP000242457    UP000005203    UP000053105    UP000075809    UP000078492    UP000078542    UP000075884    UP000075886    UP000078541    UP000005205    UP000053097    UP000279307    UP000007755    UP000078540    UP000000311    UP000069272    UP000076408    UP000075902    UP000075840    UP000075881    UP000008237    UP000075920    UP000007062    UP000075882    UP000075885    UP000075901    UP000069940    UP000249989    UP000008820    UP000000673    UP000075880    UP000075883    UP000030765    UP000002320    UP000019118    UP000030742    UP000007266    UP000009046    UP000085678    UP000261560    UP000075903    UP000264820    UP000230750    UP000261400    UP000242188    UP000257200    UP000028760    UP000001555    UP000081671    UP000001074    UP000054359    UP000265180    UP000233020    UP000246464    UP000005215    UP000001038    UP000001075    UP000030759    UP000233140    UP000029965    UP000028761    UP000233080    UP000009130    UP000233100    UP000006718    UP000233120    UP000233180    UP000233200    UP000273346    UP000248480    UP000189704    UP000008225    UP000233160    UP000010552    UP000001519    UP000001073   
Pfam
PF00160   Pro_isomerase        + More
PF00400   WD40
PF14664   RICTOR_N
PF14668   RICTOR_V
PF14666   RICTOR_M
PF14663   RasGEF_N_2
Interpro
IPR036322   WD40_repeat_dom_sf        + More
IPR015943   WD40/YVTN_repeat-like_dom_sf       
IPR001680   WD40_repeat       
IPR029000   Cyclophilin-like_dom_sf       
IPR017986   WD40_repeat_dom       
IPR002130   Cyclophilin-type_PPIase_dom       
IPR011047   Quinoprotein_ADH-like_supfam       
IPR016024   ARM-type_fold       
IPR029451   RICTOR_M       
IPR029452   RICTOR_V       
IPR028267   Pianissimo_N       
IPR029453   Rictor_IV       
IPR028268   Pianissimo_fam       
SUPFAM
SSF50891   SSF50891        + More
SSF50978   SSF50978       
SSF50998   SSF50998       
SSF48371   SSF48371       
Gene 3D
PDB
5YZG     E-value=0,     Score=2066

Ontologies

Topology

Length:
624
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0352900000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00300
outside
1  -  624
 
 

Population Genetic Test Statistics

Pi
20.05761
Theta
20.796732
Tajima's D
-0.954937
CLR
0.584988
CSRT
0.146142692865357
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号