SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11728
Annotation
Retrotransposable_element_Tf2_155_kDa_protein_type_2_[Papilio_machaon]
Location in the cell
Mitochondrial   Reliability : 2.001
 

Sequence

CDS
ATGCCGGCAAACCCTGCGACTAGTACTGGTGTGCAAGTTAATATTATACAACCTAGTACTTCCCAACATGTAGACAGCATTGCTCCGAGTGAGACGTCTAAGTCAAAATCATCACGCTCGTCATCCACAATTAAGGCTCAAAAGGCCGCCGTAGAGGCTCTCGCCCTGCGCCGACGTCTTGAGCACGAGCAGGAGCTGGCTGAACGTGAGAGGCAACGTGAAAGTCGACTGGCAGCACTCCGTCAGCAGGTAGAGGAGGGCGAACTGAAGGCCGAACTTGCCGCTCTCGACGCGGAAGCCGCGGCAAGTCATAGCAGTCGCAGTGGTTCTGCCAGGGTAAGCGTAGAAAGAACAGAAAGATGGGTACAAAGTTTAGGACAGCCAGTTTGCGTTGGCGAAAATACAGTTAATAGAGGCATCCCCGCAGTAGGGCGAGAGCAAGTATTGGTTCCGCCTCCCGGCCACCAGGCACCTCTGCCGGCCACTGGGTCAACTGCATCCCCTGTTAACCGTTTTGTTCATCAGAAACAACTTTTAAACGTCATTAAAGCGTCCGAGGCGGCCGTACTTACGCGACCGCTCATTTCCACGGAGGTTGATCAGAGTAGTCTGCTTCAGGCTGTTGCTGACACTGCAGCTGCGGCCAAGGCGCTTGCTACTTCGCACCGTCATAAACATAAGATCGAATTGTTTCCTTTCGACGGAGACGCCTTAACATGGCTACATTTTAAACGTATTTTTGATTTAACCAAAAACAATTTTTCAAATATTGAAAATATTAGTCGGTTACAAAATGCACTTCGCGGCGCGGCCCGAGATGCAGTCGCGTCACTGTTGCTGGCTACAGACAACCCGAACGATATTATAAGAGCTCTGGAGGAGAACTTCGCTCGCCCGGAAATTATAGTATTTAAGGAAGTCTCCGCTCTTAAAAATCTACCACGTTTGGGAAATGACTTGAAAGAGTTAATTACGATAACGAATAAGGGTAGGCACACACGAGACACATTTTTAGTGAAAAATGCGAGAGCTATGGAGTCTTTGTCTCTGCGTCCTCAAACGATTAGGCAGGAAACTATTGCTTCTTTCGCACATTTAGCGAATTTACCTTGCAACGTAACTTATGAAGATGCTACACCAACAGTTTTAATTGGTGCAGAGCATTGGCATTTGTCAATCAGCAGCGAGGTACGGTGTGATGGTAAGAATGAACCCGTTGCCTGTTTAACTGCCTTAGGCTGGGTGCTTTATGGAATCGCGTCCAGTAAAACTAAATCAGTGGAGTTTGTTAATCACGGTGTGTGTATCGAACCTTCCGATGAGGAGAAATTAGACTCTCTTATTAGGGAACAATACAAAATTGATTCGTTAGGTATTTCTAAAAAAGAAACTCTACATTCTAAGTCAGATAAACGTGCAGTCGAGATTTTAGAAAAAACTGCTAGACGTCTCCCCACTTCTGGTCGATTTGAGGTGGGTTTGCCGTGGCGTGACGATATACAACGCATTCCCGACAGCTACCCTCAAGCCATGTCACGATTTTTAAGTCTAGAAAGGCGCATGGCTAAAGATGCTGACTTTGCAAAAGCATATGACGTGTTCATTTCAAACATGATCGCTAAAGGCTATGCAGAAGAATGA
Protein
MPANPATSTGVQVNIIQPSTSQHVDSIAPSETSKSKSSRSSSTIKAQKAAVEALALRRRLEHEQELAERERQRESRLAALRQQVEEGELKAELAALDAEAAASHSSRSGSARVSVERTERWVQSLGQPVCVGENTVNRGIPAVGREQVLVPPPGHQAPLPATGSTASPVNRFVHQKQLLNVIKASEAAVLTRPLISTEVDQSSLLQAVADTAAAAKALATSHRHKHKIELFPFDGDALTWLHFKRIFDLTKNNFSNIENISRLQNALRGAARDAVASLLLATDNPNDIIRALEENFARPEIIVFKEVSALKNLPRLGNDLKELITITNKGRHTRDTFLVKNARAMESLSLRPQTIRQETIASFAHLANLPCNVTYEDATPTVLIGAEHWHLSISSEVRCDGKNEPVACLTALGWVLYGIASSKTKSVEFVNHGVCIEPSDEEKLDSLIREQYKIDSLGISKKETLHSKSDKRAVEILEKTARRLPTSGRFEVGLPWRDDIQRIPDSYPQAMSRFLSLERRMAKDADFAKAYDVFISNMIAKGYAEE

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
546
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00183
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00089
outside
1  -  546
 
 

Population Genetic Test Statistics

Pi
16.414202
Theta
26.99891
Tajima's D
-1.49893
CLR
100.097189
CSRT
0.0584470776461177
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号