SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11712
Pre Gene Modal
BGIBMGA004170
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.369 Nuclear   Reliability : 1.832
 

Sequence

CDS
ATGGAGTGGCTCCGAAAATATTACCACACAGTTTTCTACGATAGAGCGGATCAGAGGGTCAAAGATTGGCTGTTCATGACGTCACCATGGCCAATCGTGGCGATCCTAACGACTTATCTGCTGCTCATCAAGTTTATTCTGCCCATCTACATGAGGAACAAGAGACCTTACAGTTTGAAAGGCGTTATAAAAAGCTACAACGTGACTATGATTGTTTTCAACTTGGTCGTTGCTTGGGGGATAGCAACGTCAGGTTGGACAACCACATACCATTTCGGATGCGTTCTACCAGATTATACCACGAAACCGGAACCAATGAGGATGCTCACTTTCATGTGGTGGACATTGACTATCAAGATGACAGAGCTATTGGAGACCGTAATATTTTTGTTGAGAAAAAAAAATCAACAGGCCTCGTTCCTTCACGTGTACCATCACGTCATCTCTTTGGTTATGATATGGTGTGGTGTCAAATATATTGGAGGAGGAGACCAACGATTGGAAAGATATGGTGTGGGAATTCTTCTCACAAAGGAAATTTCCAAATCAGTCATAAATTTTGTTCCCCTCTCAAACCGGGCCATGTTGATTAAATTAGAAGCCAAACCATTTAACATCAACATTGTCCAAGTTTATGCGCCTACAGGGGATAAACCAATGGGCCAGATAGAGGACTTATATAGGGCTATTGATACCTTATTAAAATCTACTAAGAATCACGAGTTAGTTATCGTTATGGGTGACATGAATGCGAAGGTGGGTTCGACCATTACTCCTGGAGTGACTGGTGCTTATGGCCTTGGAAACAGAAACGATAGAGGTGATACGCTTATTGAGTTTTGCCAGGATAATAACCTCATAATTGCGAACACCTTCTTTAAGCTACCACCACGTCGGCTATACACATGGACATCACCAATGCACACAGTAGACCGCGTAGTCAGAAACCAAATTGACTATGTTATGATCAACAGAAGGTATAGAAATTGTATCAAGAAGGCGCAAACCTACCCCGGTGCAGACATTGGGTCAGATCATAACCCAGTGGTGGTAGACGTAGCATGCAAGCTGAAGAAGTTGCAGCCAAAGAGAATGGATGGAAGGCCAAACGTACGGAAGCTTGCTGAGCCCGACACACGAGCGAAGACCCACACCGCTATTAATCAATGGGCCAACGATCGTCGCACTGAAACCACTGCCTCTGACCTCGACACGTGGACTAGTCTAAAGCGAAGTGTAAAAGATATATGTCACCAATACCTCCAACCATCACAACTGGTCAAAAAACAAGATTGGATGACAGATTCAATTTTGCAGCTTATGGAAGACAGGAGGCAATTTAAGGGTACAAATCCAGTAATGTATAAGCAAATCGATGTCACCATTCGAAAAGAGATTGCGAAAGCCAAGAATGATTACTACAGCAATAAGTGCGCGCACTTGGAAGATCTCCTTCGTAAACATGACAGCTTCAATGCGCACAAGCACATCAAGGAAATGGTTGGTCATAGACGGAAATCAATGAATACTCTGACCGATGCAGGTGGGAACCTCATTCTTGACACCGATGGCAAAAAGAGAGTGTGGTGTGACTATGTTGCAGAGATGTTTGCGGACTCATCGAGGAACATTTCACCGATCACTGATCGGACTGGTCCAGCTATGTTGCGATCTGAGGTTTTGCGGGCCTTGAAAGCTGCTAAAACAGGCAATCTTCCTAGTGACTGGCTAAAATCCACATTCATCACGATACCCAAGAAGCAAAATGCCAAAAAATGTGGAGAGTATCGTATGATTAGTCTGATGAGCCATGTCCTAAAAGTATTCTTGAACATCATACAGAATAGAATACGGCCAAAATGTGATGAACAACTGGGCGATAGCCAATTTGGATTTCGATCTGGTGTTGGCACCAGAGAAGCTCTTTTTGCTCTCAACGTTCTCGTACAGAAATGCAGAGACATGCAAACTGATGTCTTTTTGTGCTTCATAGACTACGAAAAGGCATTTGACCGAGTTAAACATCATCAACTTTTTAGCCTTTTATGTGACATTGGTCTAGATGGTAAGGACGTCAGAATCATCCGCAACCTGTACGAGAAGCAGGTGGCTACGATAAGAGTCGAAAATGAGGAAACCGACCAAGTTGAGATCTGTCGTGGGGTCCGGCAGGGGTGTGTCTTATCCCCGTTGCTTTTTAACATCTACTCAGAGGCTGTGATGTCAAAAGCTCTTGAAAATCTTGAAGTGGGAATAGGAATCAACGGCAGGGTCGTTAACAACTTGCGTTATGCGGACGACACTATCCTTATTGCAGCATCGGAAGCCGATTTGCAAGCAATTGTGAATAAGGTTAATGAGTGCAGCGAAGAAGCCGGGTTGTCGATAAACATAAGCAAGACCAAGTTCATGGTAGTCTCAAGAAACCCGGATTTGAGTTCAAGCGTATCTGTAGCTGGGAAACAACTAGAGCGGGTACGACAGTACAAGTATTTAGGGGCTTGGGTAAACGAAGCATGGGAATCTGATCAAGAAATCAAGACCCGGATAGAAACTGCTCGAGCCTCTTTTAATAAAATGAGGAAAGTTCTTTGCTGTCGTCAACTGAATATAAAGCTCCGAGTCAGGCTACTCATGTGCTATATCTGGCCTATTGTCATGTATGGTTGCGAAACGTGGACCCTGAAAGAGGACACTACAAGACGCCTACAGGCATTCGAGATGTGGTGCTACCGTCGCATGTTACGCATTGGTTGGACGCAGAGGGTCAGGAACGAAACCGTGCTTCAGCGCGTTCATATGTCCCGGAAAATGCTGCCTGCTATCAAAAAGCGCAAGATAGAGTATCTCGGCCACGTGCTCAGGAACGATCGATACATGCTGCTCCAGCTGATAATTATGGGCAAAGTGGACGGAAAGAGACGTGCTGGGCGAAGAAAGAAATCATGGCTCCGGAATATCCGGGAGTGGACCGGTATTGCCTCCGTCGAACAGCTGTTCCGGCTGGCTGCAGATAAAAACGAATATAGAAAGCTAACGGCCAACCTTCAGGATTGA
Protein
MEWLRKYYHTVFYDRADQRVKDWLFMTSPWPIVAILTTYLLLIKFILPIYMRNKRPYSLKGVIKSYNVTMIVFNLVVAWGIATSGWTTTYHFGCVLPDYTTKPEPMRMLTFMWWTLTIKMTELLETVIFLLRKKNQQASFLHVYHHVISLVMIWCGVKYIGGGDQRLERYGVGILLTKEISKSVINFVPLSNRAMLIKLEAKPFNINIVQVYAPTGDKPMGQIEDLYRAIDTLLKSTKNHELVIVMGDMNAKVGSTITPGVTGAYGLGNRNDRGDTLIEFCQDNNLIIANTFFKLPPRRLYTWTSPMHTVDRVVRNQIDYVMINRRYRNCIKKAQTYPGADIGSDHNPVVVDVACKLKKLQPKRMDGRPNVRKLAEPDTRAKTHTAINQWANDRRTETTASDLDTWTSLKRSVKDICHQYLQPSQLVKKQDWMTDSILQLMEDRRQFKGTNPVMYKQIDVTIRKEIAKAKNDYYSNKCAHLEDLLRKHDSFNAHKHIKEMVGHRRKSMNTLTDAGGNLILDTDGKKRVWCDYVAEMFADSSRNISPITDRTGPAMLRSEVLRALKAAKTGNLPSDWLKSTFITIPKKQNAKKCGEYRMISLMSHVLKVFLNIIQNRIRPKCDEQLGDSQFGFRSGVGTREALFALNVLVQKCRDMQTDVFLCFIDYEKAFDRVKHHQLFSLLCDIGLDGKDVRIIRNLYEKQVATIRVENEETDQVEICRGVRQGCVLSPLLFNIYSEAVMSKALENLEVGIGINGRVVNNLRYADDTILIAASEADLQAIVNKVNECSEEAGLSINISKTKFMVVSRNPDLSSSVSVAGKQLERVRQYKYLGAWVNEAWESDQEIKTRIETARASFNKMRKVLCCRQLNIKLRVRLLMCYIWPIVMYGCETWTLKEDTTRRLQAFEMWCYRRMLRIGWTQRVRNETVLQRVHMSRKMLPAIKKRKIEYLGHVLRNDRYMLLQLIIMGKVDGKRRAGRRKKSWLRNIREWTGIASVEQLFRLAADKNEYRKLTANLQD

Summary

EMBL
GU815089    ADF18552.1    NWSH01001998    PCG69477.1    GFAH01000222    JAV48167.1    + More
QIAP01000240    PYX61602.1    GGMR01018096    MBY30715.1    KF881087    AIJ27486.1    NCKU01004395    RWS06003.1    NEVH01002141    PNF42599.1    NEVH01017534    PNF24114.1    NEVH01017570    PNF23798.1    NEVH01013959    PNF28275.1    NEVH01021219    PNF19787.1    NEVH01020937    PNF20581.1    NEVH01012082    PNF31006.1    NEVH01005277    PNF39212.1    NEVH01023985    PNF17546.1    NEVH01022640    NEVH01008218    NEVH01005885    PNF18513.1    PNF34430.1    PNF38481.1    NEVH01002684    PNF41704.1    FJ265547    ADI61815.1    NEVH01015309    PNF27009.1    NEVH01017460    PNF24248.1    NEVH01014359    PNF27789.1    NEVH01019075    PNF22955.1    NEVH01003750    PNF40091.1    NEVH01013275    PNF29009.1    NEVH01019971    PNF22037.1    NEVH01014358    PNF27914.1    NEVH01023960    NEVH01010501    PNF17732.1    PNF32290.1    NEVH01007402    PNF35815.1    NEVH01018372    NEVH01014371    NEVH01011208    NEVH01002697    NEVH01002552    PNF23678.1    PNF27673.1    PNF31697.1    PNF41592.1    PNF42118.1    NEVH01025135    PNF15828.1    NEVH01019064    PNF23230.1    PNF27813.1    GDHC01007098    GDHC01001590    JAQ11531.1    JAQ17039.1    FJ265548    ADI61816.1    KF881086    AIJ27485.1    NWSH01000469    PCG76200.1    FJ265553    ADI61821.1    FJ265546    ADI61814.1    GU815090    ADF18553.1    NEVH01016289    PNF26277.1    NEVH01013553    PNF28765.1    NEVH01021921    PNF19488.1    NEVH01011186    PNF32183.1    NEVH01016335    NEVH01006721    PNF25462.1    PNF37115.1    NEVH01003500    PNF40666.1    PNF37211.1    PNF37310.1    NEVH01013215    PNF29703.1    NEVH01020865    PNF20863.1    AHAT01017643    NEVH01027104    PNF13657.1    NEVH01026085    PNF14968.1    NEVH01020851    NEVH01013954    NEVH01006574    NEVH01001358    NEVH01001354    PNF21237.1    PNF28332.1    PNF37782.1    PNF42792.1    PNF42884.1    NEVH01017540    PNF24056.1    NEVH01005896    PNF38208.1    NEVH01011205    PNF31711.1    NEVH01020940    PNF20478.1    NEVH01023953    PNF17877.1    NEVH01021931    PNF19256.1    NEVH01027067    PNF13944.1    NEVH01012564    PNF30212.1    NEVH01017443    PNF24485.1    NEVH01000609    PNF43402.1    PNF38212.1    NEVH01020333    PNF21790.1    AHAT01008485    NEVH01017452    PNF24293.1    NEVH01019066    PNF23173.1    NEVH01025668    PNF15041.1    KZ150025    PZC74827.1    AAGJ04171899    NEVH01013243    PNF29503.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR000637   HMGI/Y_DNA-bd_CS       
IPR002138   Pept_C14_p10       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
5HHL     E-value=4.11769e-12,     Score=176

Ontologies

Topology

Length:
1018
Number of predicted TMHs:
4
Exp number of AAs in TMHs:
87.4000500000001
Exp number, first 60 AAs:
21.88899
Total prob of N-in:
0.00073
POSSIBLE N-term signal
sequence
outside
1  -  28
TMhelix
29  -  51
inside
52  -  71
TMhelix
72  -  94
outside
95  -  108
TMhelix
109  -  131
inside
132  -  137
TMhelix
138  -  160
outside
161  -  1018
 
 

Population Genetic Test Statistics

Pi
25.070393
Theta
27.248279
Tajima's D
-0.62575
CLR
0.656864
CSRT
0.222388880555972
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号