SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11708
Pre Gene Modal
BGIBMGA009638
Annotation
PREDICTED:_uncharacterized_protein_LOC106714598_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 4.724
 

Sequence

CDS
ATGTCTTATTTGGGAAATTTACCAATTTACGATCATAAAACATGTGAATGGTCTATTTTCAAGAGTCGTTTAACACAGTTTTTAAAAGTAAATGACGTATCGGAAGAAAAGAAAAGTGCTATCCTCATTACGCACCTCTCCGATGAGGCGTACCGTCTAGTGCGAAATTTAGCATACCCCAAAGATGCTGATTCATTTTCGTATGTGGAGCTGGTTTCATTACTCGATAATCATTTTAAGCCAAAGAAGTGTTCATATACCGACAAGGCTCGTTTTTATGGGGCTACGAGAACCCCAGGCGAATCATTAGGAGACTGGGCGGCGCGACTTAGGGGGTTGGCAAGTTATTGCGAATTCGGCGCGGCTTTGGAAACGAACCTTACGGATCGTTTTGTCCTAGGCCTGGGCTCAGGTCCAGCACGAGATAAGCTGTACGAGCAGGACCCATCAAAAATGAAAATCGATCGAGCGTTAGAAATAGCCCAGCAGGCAGAGAGTGCGAGGGAGGCTAAGTTCATGGAAGTTAGTGTTAAGGAAGAACCTGTGTACCGTGCCTCCTTCACGCTCGACGATAGACGTGAAGCTAATCGACGAGCGCGGACGAGTGAGCCAAGCAGTGGTTATTCAGGGCAGCGGCAGCGGTCCCACCTTGGTGATGGTCAATCAGTTCGCGGGCAGCAACCACGTCGTGACTTCCCAAGGTGCTCGGTTTGCGGGTTAAGAAACCACGACGAAGAGAAGTGCCGTTACAAGGGCTATCGCTGTCAGAAGTGCGGTGAAAAGGGACATTTAAAAAAAGTGTGTGACAAAAATGTGCAGATCAATAATATTTGTGATGACCACGATAAAGGTGTCGGCCACATTCCGGATCCTGACCTTTGTGAGGAATGTCATAATTATAGTTTAAAGCATATCGATCAGATTCTTAGAAGTAAGGAAGATTTTGAAAAAAAGAGTTGTATTACTAGTACGTCGCCTCCATTTTCCAACACAACAATTTTAGCAAAACCTAACATAACCAATTATAGCGATGGTTCGATTATGACTTCTGTAGCTCAACAGGCTGTGGGAATGGAAAGTGGAGACGGACGTAACGAGCAAGAAAATGTAGTAACCGATATTGGTGATATTGTCCAGCCAACTGACGAGATCTGGGGTGATTGCGAAGAAGTTGACCTTGAACGGGAGAACCTAGTTCCTGGCAGTTCAGCCGAGCCTCCGGCGCCGCCGCTGGCGTTGTCGTCACCAGTCGCGTCTAAACGTACCTCACCTGTTTCTGATCCACATCAGCCCGGACCCTCGTCCTTAACTTATTCCCCACCGCTCACACGTCGCAAGAAGAGAGTTGATTACAAGCAATTCTATTATTGA
Protein
MSYLGNLPIYDHKTCEWSIFKSRLTQFLKVNDVSEEKKSAILITHLSDEAYRLVRNLAYPKDADSFSYVELVSLLDNHFKPKKCSYTDKARFYGATRTPGESLGDWAARLRGLASYCEFGAALETNLTDRFVLGLGSGPARDKLYEQDPSKMKIDRALEIAQQAESAREAKFMEVSVKEEPVYRASFTLDDRREANRRARTSEPSSGYSGQRQRSHLGDGQSVRGQQPRRDFPRCSVCGLRNHDEEKCRYKGYRCQKCGEKGHLKKVCDKNVQINNICDDHDKGVGHIPDPDLCEECHNYSLKHIDQILRSKEDFEKKSCITSTSPPFSNTTILAKPNITNYSDGSIMTSVAQQAVGMESGDGRNEQENVVTDIGDIVQPTDEIWGDCEEVDLERENLVPGSSAEPPAPPLALSSPVASKRTSPVSDPHQPGPSSLTYSPPLTRRKKRVDYKQFYY

Summary

Pfam
PF17921   Integrase_H2C2        + More
PF00665   rve
PF00078   RVT_1
PF17917   RT_RNaseH
Interpro
IPR012337   RNaseH-like_sf        + More
IPR036875   Znf_CCHC_sf       
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR041373   RT_RNaseH       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       
Gene 3D

Ontologies

Topology

Length:
456
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00154
outside
1  -  456
 
 

Population Genetic Test Statistics

Pi
19.99917
Theta
21.225908
Tajima's D
-1.06822
CLR
4.287969
CSRT
0.124693765311734
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号