SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11701
Annotation
Retrovirus-related_Pol_polyprotein_from_type-2_retrotransposable_element_R2DM_[Exaiptasia_pallida]
Location in the cell
Nuclear   Reliability : 2.586
 

Sequence

CDS
ATGAGAAATATCAAAAATAAACTATACGAGAAATTCAAAATTCACAATGATCAGGATCTAAATAACACCATTGAGATACTAAAACAAAAAGTTAAGGCTTTAGCAGGTAGACTTCGCAGATATGACGAAATAAACCAAAGGAAAATTCAGAATAAACAATTTGCTGAGAACCAACACAAATTTTTTAGGTCTCTGAATAGCTCGCAACACAATCCCACACAAATCCCTTCTCAGTCGGAAATAGAAAACTTCTGGACGACAATCTTATCAAACCCAATATCGTACAACAAAGAAGCTCACTGGATAACACAAATAGCAAATTCATCAAATGAAATAGAGGAACACATATTTGAAGAGATAGATGTAGGAAAATTGAGAACCGCGATCCGAAAATCCCAGAACTGGAAATCACCAGGAATAGACAAAATACATAACTATTATCTCAAATACCTCACTAGTACACACAAATATATAGCCAAACTATTTGATAGGATAATTAAAGGTACCGAAGTCATAGATAGTTGGTTCACAAGGGGCCGAGTTGTTTTAATACCTAAAGACGAAAATACTCAAGACCCGAAGAACTGGCGTCCTATTGCTTGTTTGCCAACTATGTACAAGATTTTAACCTCCATAATAGCCAATGAACTCTACAAACATTGCGATAAAAATAACATCATAGCCCTGGAACAGCGAGGTTGCAGACGCGGGGCACGTGGCTGCAAAGATCACCTCATGATCAACAAAGCCATACTGGAAGATGCACATAAATGCCAGAAGAATTTAAGTACGGCTTGGATTGACTACCGGAAGGCTTTTGATAGCATATCACATGAATGGCTACTCAAAGTACTTGAGCTCTATAAATGTCCACCCGTTGTCAGAAATTTTCTGAGGTTGGTCATGCCCATGTGGAGTGTGGTCATGACGGCTCGCGGTGCGAACGGATCTGTAACCACTGAACCTATATACATCCGACGAGGAATATTTCAAGGTGATTCACTCTCCCCTCTTTTGTTCTGTCTGGGTATCAACCCCATCTCCCAAATTCTCAACCAATACCAATTAAAAGGATATACACTTAAAGACAATAATATAATAAATCATCTCTTATACATGGATGACCTGAAAATTTATTCGAACAGTAAAACAAACCTTAAAGTTTTAATAGATAGTGCAGAAATCTTTACAGGAGATATAGGCATGCAATTCGGGCTAAAAAAATGTAATATTCTACATCTAGTCGCGGGTAGGAGAAAAGAACATCGCGGTCGAGGGCACGTTCTGCTGAGCGGAGACGAGTTCAGGCACCTGAGATTAGATGAGAAGTACAAATACCTAGGGATAGATGAGGCAGGCAAAATCGACCACAATGAAGTCAGGCAACAAATACAAAAAGAATATTTCCGTCGCGTCAAATCCGTCACAGGATCGCAACTCAATGCACGAAATATCTTGCGAGCCTTAAATATATACGCTGTACCGGTTCTTTTGTATACATTTGGCATAATAAATTACAAAACCGCGGACCTCAAGAAGATTGATGTAAAGACCAGAAAGATTTTAGCAATGAATAAAGCACACCAACAGAAAGCAGATGTAGATAGGTTATATATACCGATCGATCAAGGTGGAAGAGGGCTAACAAATCTAGAAACACTATACAAAACACAAATAATCAAATACAAATCATACATAGAAACTGAAAAAGATCATATACTTAGAGCAATAGTGGAACATGATAAAAATAAAAGTAAATATTCAATATTTAAAGAAACACGATCAAATCTAAATGAAATAGGATTACAGCAAAATGAAAAATATACAGACAAAGAATTAAAAAATGCAGTAGTTAAGACAAAAATAGAGATAATAAAAGCGAAACCGCTCCACGGTCAATTTTACAAAGCAGTACTAGAAAAAGAAAATATCGACAGAGCGCAATCCTTCCAATGGTTCAAAAGGCAACCGGTGTCTCCAGCATTGGAATCAGCCATATTTGCAATTCAAGATCAGGCAGTGGTGACCAGACAACATGAAAGAGACATAATGAAACGCCAAGTTGATGGTAGGTGTCGGTTATGCTGCATTAAAGATGAGACCACACAGCACATTGTCTCAGGATGCGAAAAGCTTGCTGGCACTTATTACACCAAAAGGCACAATAACATAGTGCAATATGTTTTCTGGTCGCTAGCTAAAAAGCATGCGTTTCAGGTCTCCGACCTGTGGTGGCGAGAACACCTTACGCAGCCGCAGGTTAGGGAGAATGAAGGTGCAAAAATAATGTGGGAGATACCGGTTCAAACCGACGTTACAATAGTTCACAATAGACCAGACATTATTTATATAAACAAAACGGACAACAAAACATACCTCATAGATGTAACAGTTCCCTCAGACTACAATATAGGAGCAAAAGAAATAGAAAAGCTAAGTAAATACCATGCACTCAAAACCGAAATAACCAGATTATGGAAAACACACACAGAAATAGTACCAATAGTAATAGGAGCAACCGGAGTAATAGCCAAAAGCCTACAGAAATACTTAGATAAATTAGATGCAAACATCAACCCACACATCATGCAGAAACAAGCTGCCATACACACGGTCACCATCATCACGAAAGCACGAAGCATATTATCACATAATTACATTTCAAAAGAAGTCCTTGAAGAAATTAAAAGTAAAGCAGAACAAGCGTATCTATTACCTGACGTGTACAGTCGTACTGCCTTGCCAGAAACCATCACACAGACAACAGCAAACACTCTACCTGAACCTATTTACACCGCCGATTTACTACATCAAGAAAACTTCACACAACAGACACAGCACATTCACCCACCACCAAATACTGACACTCAAGAACAAACCCTTACATTCACTCAAATAGAACCTACTACACAGCTTACGGATACGATAGCGGACGAAGGAAATGAAATAGGTGAGGTTGTAGTCGATGAAAACCAAGATCCACTTGTGTTAGATTTTTTGCAAATACTAGCAGAAACTAAAGAAATACCCATTGACAACAGAACTTTCTTACCGAAACCCAAATTTAATAAACATTTTATAAAAAACCTTCAAACAATTAACAACTACATACCCACCTTGCTCGAGACAAATCAATCATTACGCGAAATAAATGACGTAATCTACGCAGCTGCTAAGACATTGATTATTAATAATAAACAAACACCTTATACCCCACCCACCATGCAAAAACCGAAACACGAACCACCGTGGAAACGTAGACTGAAACAAAAAATAGAAGATCATAGAAAGGAATTGGGAAGGTTGGTAGAAGTAAAAGCAGGTTCTAATAGTAACAAAATGAGAAATATCAAAAATAAACTATACGAGAAATTCAAAATTCACAATGATCAGGATCTAAATAACACCATTGAGATACTAAAACAAAAAGTTAAGGCTTTAGCAGGTAGACTTCGCAGATATGACGAAATAAACCAAAGGAAAATTCAGAATAAACAATTTGCTGAGAACCAACACAAATTTTTTAGGTCTCTGAATAGCTCGCAACACAATCCCACACAAATCCCTTCTCAGTCGGAAATAGAAAACTTCTGGACGACAATCTTATCAAACCCAATATCGTACAACAAAGAAGCTCACTGGATAACACAAATAGCAAATTCATCAAATGAAATAGAGGAACACATATTTGAAGAGATAGATGTAGGAAAATTGAGAACCGCGATCCGAAAATCCCAGAACTGGAAATCACCAGGAATAGACAAAATACATAACTATTATCTCAAATACCTCACTAGTACACACAAATATATAGCCAAACTATTTGATAGGATAATTAAAGGTACCGAAGTCATAGATAGTTGGTTCACAAGGGGCCGAGTTGTTTTAATACCTAAAGACGAAAATACTCAAGACCCGAAGAACTGGCGTCCTATTGCTTGTTTGCCAACTATGTACAAGATTTTAACCTCCATAATAGCCAATGAACTCTACAAACATTGCGATAAAAATAACATCATAGCCCTGGAACAGCGAGGTTGCAGACGCGGGGCACGTGGCTGCAAAGATCACCTCATGATCAACAAAGCCATACTGGAAGATGCACATAAATGCCAGAAGAATTTAAGTACGGCTTGGATTGACTACCGGAAGGCTTTTGATAGCATATCACATGAATGGCTACTCAAAGTACTTGAGCTCTATAAATGTCCACCCGTTGTCAGAAATTTTCTGAGGTTGGTCATGCCCATGTGGAGTGTGGTCATGACGGCTCGCGGTGCGAACGGATCTGTAACCACTGAACCTATATACATCCGACGAGGAATATTTCAAGGTGATTCACTCTCCCCTCTTTTGTTCTGTCTGGGTATCAACCCCATCTCCCAAATTCTCAACCAATACCAATTAAAAGGATATACACTTAAAGACAATAATATAATAAATCATCTCTTATACATGGATGACCTGAAAATTTATTCGAACAGTAAAACAAACCTTAAAGTTTTAATAGATAGTGCAGAAATCTTTACAGGAGATATAGGCATGCAATTCGGGCTAAAAAAATGTAATATTCTACATCTAGTCGCGGGTAGGAGAAAAGAACATCGCGGTCGAGGGCACGTTCTGCTGAGCGGAGACGAGTTCAGGCACCTGAGATTAGATGAGAAGTACAAATACCTAGGGATAGATGAGGCAGGCAAAATCGACCACAATGAAGTCAGGCAACAAATACAAAAAGAATATTTCCGTCGCGTCAAATCCGTCACAGGATCGCAACTCAATGCACGAAATATCTTGCGAGCCTTAAATATATACGCTGTACCGGTTCTTTTGTATACATTTGGCATAATAAATTACAAAACCGCGGACCTCAAGAAGATTGATGTAAAGACCAGAAAGATTTTAGCAATGAATAAAGCACACCAACAGAAAGCAGATGTAGATAGGTTATATATACCGATCGATCAAGGTGGAAGAGGGCTAACAAATCTAGAAACACTATACAAAACACAAATAATCAAATACAAATCATACATAGAAACTGAAAAAGATCATATACTTAGAGCAATAGTGGAACATGATAAAAATAAAAGTAAATATTCAATATTTAAAGAAACACGATCAAATCTAAATGAAATAGGATTACAGCAAAATGAAAAATATACAGACAAAGAATTAAAAAATGCAGTAGTTAAGACAAAAATAGAGATAATAAAAGCGAAACCGCTCCACGGTCAATTTTACAAAGCAGTACTAGAAAAAGAAAATATCGACAGAGCGCAATCCTTCCAATGGTTCAAAAGGCAACCGGTGTCTCCAGCATTGGAATCAGCCATATTTGCAATTCAAGATCAGGCAGTGGTGACCAGACAACATGAAAGAGACATAATGAAACGCCAAGTTGATGGTAGGTGTCGGTTATGCTGCATTAAAGATGAGACCACACAGCACATTGTCTCAGGATGCGAAAAGCTTGCTGGCACTTATTACACCAAAAGGCACAATAACATAGTGCAATATGTTTTCTGGTCGCTAGCTAAAAAGCATGCGTTTCAGGTCTCCGACCTGTGGTGGCGAGAACACCTTACGCAGCCGCAGGTTAGGGAGAATGAAGGTGCAAAAATAATGTGGGAGATACCGGTTCAAACCGACGTTACAATAGTTCACAATAGACCAGACATTATTTATATAAACAAAACGGACAACAAAACATACCTCATAGATGTAACAGTTCCCTCAGACTACAATATAGGAGCAAAAGAAATAGAAAAGCTAAGGCCGCTGCCCGGGGGCGATCGCCGGGGCACGTCTGTAGCTGGTGGCGGACGTGGCAGAATGCTAGCCAGCGACTCACGACGTACCGGCTGGTCGGGAGTCGGGGACAGGGGGGTTTGGGGTAGGTCTCCAGATGCTACAGCCGAAGAATTTAACGATGTTGCTTTGCGGGGTAGGGATATGTCTCCCACATGCTCTGCCGGCACATCGTCATCGACCACAGGTTCTATTAACGATGACGCAAGAAGGAAGTGGTCACGAACCGAATTAGATGAACTTATGTTTTGTTTTTATCTAGCCAAAGCAGGAGGGCCTGGCTATATAAAACGATTAGAAAAGATCTTTAAAGACCGAAATTCACACATCACAAAGTTTAAAAAATTCACAGGAAATACACTATCCAATCAGGCACGAAGCATATTATCACATAATTACATTTCAAAAGAAGTCCTTGAAGAAATTAAAAGTAAAGCAGAACAAGCGTATCTATTACCTGACGTGTACAGTCGTACTGCCTTGCCAGAAACCATCACACAGACAACAGCAAACACTCTACCTGAACCTATTTACACCGCCGATTTACTACATCAAGAAAACTTCACACAACAGACACAGCACATTCACCCACCACCAAATACTGACACTCAAGAACAAACCCTTACATTCACTCAAATAGAACCTACTACACAGCTTACGGATACGATAGCGGACGAAGGAAATGAAATAGGTGAGGTTGTAGTCGATGAAAACCAAGATCCACTTGTGTTAGATTTTTTGCAAATACTAGCAGAAACTAAAGAAATACCCATTGACAACAGAACTTTCTTACCGAAACCCAAATTTAATAAACATTTTATAAAAAACCTTCAAACAATTAACAACTACATACCCACCTTGCTCGAGACAAATCAATCATTACGCGAAATAAATGACGTAATCTACGCAGCTGCTAAGACATTGATTATTAATAATAAACAAACACCTTATACCCCACCCACCATGCAAAAACCGAAACACGAACCACCGTGGAAACGTAGACTGAAACAAAAAATAGAAGATCATAGAAAGGAATTGGGAAGGTTGGTAGAAGTAAAAGCAGGTTCTAATAGTAACAAAATGAGAAATATCAAAAATAAACTATACGAGAAATTCAAAATTCACAATGATCAGGATCTAAATAACACCATTGAGATACTAAAACAAAAAGTTAAGGCTTTAGCAGGTAGACTTCGCAGATATGACGAAATAAACCAAAGGAAAATTCAGAATAAACAATTTGCTGAGAACCAACACAAATTTTTTAGGTCTCTGAATAGCTCGCAACACAATCCCACACAAATCCCTTCTCAGTCGGAAATAGAAAACTTCTGGACGACAATCTTATCAAACCCAATATCGTACAACAAAGAAGCTCACTGGATAACACAAATAGCAAATTCATCAAATGAAATAGAGGAACACACATTTGAAGAGATAGATGTAGGAAAATTGAGAACCGCGATCCGAAAATCCCAGAATTGGATATCACCAGGAATAGACAAAATACATAACTATTATCTCAAATACCTCACTAGTACACACAAATATATAGCCAAACTATTTGATAGGATAATTAAAGGTACCGAAGTCATAGATAGTTGGTTCACAAGGGGCCGAGTTGTTTTAATACCTAAAGACGAAAATACTCAAGACCCGAAGAACTGGCGTCCTATTGCTTGTTTGCCAACTATGTACAAGATTTTAACCTCCATAATAGCCAATGAACTCTACAAACATTGCGATAAAAATAACATCATAGCCCTGGAACAGCGAGGTTGCAGACGCGGGGCACGTGGCTGCAAAGATCACCTCATGATCAACAAAGCCATACTGGAAGATGCACATAAATGCCAGAAGAATTTCAGTACGGCTTGGATTGACTACCGGAAGGCTTTTGATAGCATATCACATGAATGGCTACTCAAAGTACTTGAGCTCTATAAATGTCCACCCGTTGTCAGAAATTTTCTGAGGTTGGTCATGCCCATGTGGAGTGTGGTCATGACGGCTCGCGGTGCGGACGGATCTGTAACCACTGAACCTATATACATCCGACGAGGAATATTTCAAGTCGCGGGTAGGAGAAAAGAACATCGCGGTCGAGGGCACGTTCTGCTGAGCGGAGACGAGTTCAGGCACCTGAGATTAGATGAGAAGTACAAATACCTAGGGATAGATGAGGCAGGCAAAATCGACCACAATGAAGTCAGGCAACAAATACAAAAAGAATATTTCCGTCGCGTCAAATCCGTCACAGGATCGCAACTCAATGCACGAAATATCTTGCGAGCCTTAAATATATACGCTGTACCGGTTCTTTTGTATACATTTGGCATAATAAATTACAAAACCGCGGACCTCAAGAAGATTGATGTAAAGACCAGAAAGATTTTAGCAATGAATAAAGCACACCAACAGAAAGCAGATGTAGATAGGTTATATATACCGATCGATCAAGGTGGAAGAGGGCTAACAAATCTAGAAACACTATACAAAACACAAATAATCAAATACAAATCATACATAGAAACTGAAAAAGATCATATACTTAGAGCAATAGTGGAACATGATAAAAATAAAAGTAAATATTCAATATTTAAAGAAACACGATCAAATCTAAATGAAATAGGATTACAGCAAAATGAAAAATATACAGACAAAGAATTAAAAAATGCAGTAGTTAAGACAAAAATAGAGATAATAAAAGCGAAACCGCTCCACGGTCAATTTTACAAAGCAGTACTAGAAAAAGAAAATATCGACAGAGCCCAATCCTTCCAATGGTTCAAAAGGCAACCGGTGTCTCCAGCATTGGAATCAGCCATATTTGCAATTCAAGATCAGGCAGTGGTGACCAGACAACATGAAAGAGACATAATGAAACGCCAAGTTGATGGTAGGTGTCGGTTATGCTGCATTAAAGATGAGACCACACAGCACATTGTCTCAGGATGCGAAAAGCTTGCTGGCACTTATTACACCAAAAGGCACAATAACATAGTGCAATATGTTTTCTGGTCGCTAGCTAAAAAGCATGCGTTTCAGGTCTCCGACCTGTGGTGGCGAGAACACCTTACGCAGCCGCAGGTTAGGGAGAATGAAGGTGCAAAAATAATGTGGGAGATACCGGTTCAAACCGACGTTACAATAGTTCACAATAGACCAGACATTATTTATATAAACAAAACGGACAACAAAACATACCTCATAGATGTAACAGTTCCCTCAGACTACAATATAGGAGCAAAAGAAATAGAAAAGCTAAGTAAATACCATGCACTCAAAACCGAAATAACCAGATTATGGAAAACACACACAGAAATAGTACCAATAGTAATAGGAGCAACCGGAGTAATAGCCAAAAGCCTACAGAAATACTTAGATAAATTAGATGCAAACATCAACCCACACATCATGCAGAAACAAGCTGCCATACACACGGTCACCATCATCACGAAAGTCTTGGGGGATACGGTCTTCGTAGGAGGGGAAACTGAGCCACCCTTTCCCTGA
Protein
MRNIKNKLYEKFKIHNDQDLNNTIEILKQKVKALAGRLRRYDEINQRKIQNKQFAENQHKFFRSLNSSQHNPTQIPSQSEIENFWTTILSNPISYNKEAHWITQIANSSNEIEEHIFEEIDVGKLRTAIRKSQNWKSPGIDKIHNYYLKYLTSTHKYIAKLFDRIIKGTEVIDSWFTRGRVVLIPKDENTQDPKNWRPIACLPTMYKILTSIIANELYKHCDKNNIIALEQRGCRRGARGCKDHLMINKAILEDAHKCQKNLSTAWIDYRKAFDSISHEWLLKVLELYKCPPVVRNFLRLVMPMWSVVMTARGANGSVTTEPIYIRRGIFQGDSLSPLLFCLGINPISQILNQYQLKGYTLKDNNIINHLLYMDDLKIYSNSKTNLKVLIDSAEIFTGDIGMQFGLKKCNILHLVAGRRKEHRGRGHVLLSGDEFRHLRLDEKYKYLGIDEAGKIDHNEVRQQIQKEYFRRVKSVTGSQLNARNILRALNIYAVPVLLYTFGIINYKTADLKKIDVKTRKILAMNKAHQQKADVDRLYIPIDQGGRGLTNLETLYKTQIIKYKSYIETEKDHILRAIVEHDKNKSKYSIFKETRSNLNEIGLQQNEKYTDKELKNAVVKTKIEIIKAKPLHGQFYKAVLEKENIDRAQSFQWFKRQPVSPALESAIFAIQDQAVVTRQHERDIMKRQVDGRCRLCCIKDETTQHIVSGCEKLAGTYYTKRHNNIVQYVFWSLAKKHAFQVSDLWWREHLTQPQVRENEGAKIMWEIPVQTDVTIVHNRPDIIYINKTDNKTYLIDVTVPSDYNIGAKEIEKLSKYHALKTEITRLWKTHTEIVPIVIGATGVIAKSLQKYLDKLDANINPHIMQKQAAIHTVTIITKARSILSHNYISKEVLEEIKSKAEQAYLLPDVYSRTALPETITQTTANTLPEPIYTADLLHQENFTQQTQHIHPPPNTDTQEQTLTFTQIEPTTQLTDTIADEGNEIGEVVVDENQDPLVLDFLQILAETKEIPIDNRTFLPKPKFNKHFIKNLQTINNYIPTLLETNQSLREINDVIYAAAKTLIINNKQTPYTPPTMQKPKHEPPWKRRLKQKIEDHRKELGRLVEVKAGSNSNKMRNIKNKLYEKFKIHNDQDLNNTIEILKQKVKALAGRLRRYDEINQRKIQNKQFAENQHKFFRSLNSSQHNPTQIPSQSEIENFWTTILSNPISYNKEAHWITQIANSSNEIEEHIFEEIDVGKLRTAIRKSQNWKSPGIDKIHNYYLKYLTSTHKYIAKLFDRIIKGTEVIDSWFTRGRVVLIPKDENTQDPKNWRPIACLPTMYKILTSIIANELYKHCDKNNIIALEQRGCRRGARGCKDHLMINKAILEDAHKCQKNLSTAWIDYRKAFDSISHEWLLKVLELYKCPPVVRNFLRLVMPMWSVVMTARGANGSVTTEPIYIRRGIFQGDSLSPLLFCLGINPISQILNQYQLKGYTLKDNNIINHLLYMDDLKIYSNSKTNLKVLIDSAEIFTGDIGMQFGLKKCNILHLVAGRRKEHRGRGHVLLSGDEFRHLRLDEKYKYLGIDEAGKIDHNEVRQQIQKEYFRRVKSVTGSQLNARNILRALNIYAVPVLLYTFGIINYKTADLKKIDVKTRKILAMNKAHQQKADVDRLYIPIDQGGRGLTNLETLYKTQIIKYKSYIETEKDHILRAIVEHDKNKSKYSIFKETRSNLNEIGLQQNEKYTDKELKNAVVKTKIEIIKAKPLHGQFYKAVLEKENIDRAQSFQWFKRQPVSPALESAIFAIQDQAVVTRQHERDIMKRQVDGRCRLCCIKDETTQHIVSGCEKLAGTYYTKRHNNIVQYVFWSLAKKHAFQVSDLWWREHLTQPQVRENEGAKIMWEIPVQTDVTIVHNRPDIIYINKTDNKTYLIDVTVPSDYNIGAKEIEKLRPLPGGDRRGTSVAGGGRGRMLASDSRRTGWSGVGDRGVWGRSPDATAEEFNDVALRGRDMSPTCSAGTSSSTTGSINDDARRKWSRTELDELMFCFYLAKAGGPGYIKRLEKIFKDRNSHITKFKKFTGNTLSNQARSILSHNYISKEVLEEIKSKAEQAYLLPDVYSRTALPETITQTTANTLPEPIYTADLLHQENFTQQTQHIHPPPNTDTQEQTLTFTQIEPTTQLTDTIADEGNEIGEVVVDENQDPLVLDFLQILAETKEIPIDNRTFLPKPKFNKHFIKNLQTINNYIPTLLETNQSLREINDVIYAAAKTLIINNKQTPYTPPTMQKPKHEPPWKRRLKQKIEDHRKELGRLVEVKAGSNSNKMRNIKNKLYEKFKIHNDQDLNNTIEILKQKVKALAGRLRRYDEINQRKIQNKQFAENQHKFFRSLNSSQHNPTQIPSQSEIENFWTTILSNPISYNKEAHWITQIANSSNEIEEHTFEEIDVGKLRTAIRKSQNWISPGIDKIHNYYLKYLTSTHKYIAKLFDRIIKGTEVIDSWFTRGRVVLIPKDENTQDPKNWRPIACLPTMYKILTSIIANELYKHCDKNNIIALEQRGCRRGARGCKDHLMINKAILEDAHKCQKNFSTAWIDYRKAFDSISHEWLLKVLELYKCPPVVRNFLRLVMPMWSVVMTARGADGSVTTEPIYIRRGIFQVAGRRKEHRGRGHVLLSGDEFRHLRLDEKYKYLGIDEAGKIDHNEVRQQIQKEYFRRVKSVTGSQLNARNILRALNIYAVPVLLYTFGIINYKTADLKKIDVKTRKILAMNKAHQQKADVDRLYIPIDQGGRGLTNLETLYKTQIIKYKSYIETEKDHILRAIVEHDKNKSKYSIFKETRSNLNEIGLQQNEKYTDKELKNAVVKTKIEIIKAKPLHGQFYKAVLEKENIDRAQSFQWFKRQPVSPALESAIFAIQDQAVVTRQHERDIMKRQVDGRCRLCCIKDETTQHIVSGCEKLAGTYYTKRHNNIVQYVFWSLAKKHAFQVSDLWWREHLTQPQVRENEGAKIMWEIPVQTDVTIVHNRPDIIYINKTDNKTYLIDVTVPSDYNIGAKEIEKLSKYHALKTEITRLWKTHTEIVPIVIGATGVIAKSLQKYLDKLDANINPHIMQKQAAIHTVTIITKVLGDTVFVGGETEPPFP

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
3108
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.07425000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04909
outside
1  -  3108
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
70.000402
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号