Gene

KWMTBOMO11679

Pre Gene Modal

BGIBMGA004136

Annotation

PREDICTED:_tumor_susceptibility_gene_101_protein_[Amyelois_transitella]

Location

Bomo_Chr19(+):11158263-11159613      View in EpiBrowser

Full name

Tumor susceptibility gene 101 protein      

Alternative Name

ESCRT-I complex subunit TSG101

Location in the cell

Nuclear   Reliability : 3.145

CDS

ATGACCAACCACGAAGCTGTATTGAAACAATTGTTATCGAAATATAAACATCGGGACTTCACTTCTCGAGAAGTAATTAACTTGCTACAAGTGTACAGAAGCTTAACTTATCGTTTGGAAGCATTTATCTTTAATAATGGTTCCAGAAAAGAGCTTTTGAATATTGAAGGTACAATTCCCGTAAATTACAAAGGAGCCTTTTATAACATACCCGTGTCAATATGGCTCATGGACACTCATCCTCAAAATGCGCCTTTGTGTTTTGTGAAACCGACATCTGACATGTCTATCAAGGTATCGAAGTACGTTGACACTAACGGAAAAGTTTATTTACCTTATCTTCACGAGTGGTCTTCGAATTCTTCCACTTTGAAGAATCTGGTGCAGTGCATGATTACAGCATTTGGTGAATTACCTCCGGTGTATTCTAAGCCACGTAATGTTGCTATGCCTATGTTCGCTGCGAAACCGTTTATGCCAGAATCGTCAGGATATCCCTTACCAATGCCTACTCCAGGGTATCCTACTACAACACCATATCCTACAACTTCAAGTTTACCATATCCTAATTATGGTTCACCATATCCTGGAACAGCGAGTACAAATGGTCTGCCATATCCTCCAGCACCAATAACTACACCTTACCCCCCTGCATCACAATATGGTCCTAGTACAGAAGGTGCTGGGGGTACCATTACTGAAGAGCATATTAAAGCATCGCTACTGTCTGCTGTTGAAGACAAATTAAGAAGACGTCTTAAAGAACAATCTCAGCAATCACAGGCTGAACTTGAAACCTTACGTAGGACTCAGCAAGAACTTGGTGAAGGAAAGTCTCGGATTGAAGACATAATTACGAGACTTCAAAGGGAGCGTTCAGAACTAGATAAGAATGTAATGATTTTACAAGAGAAGGAAAAAGAGTTGCAAGCAGCCGTGGAACGTTTGGCTGACCAGGAGGGTGTGGATGTTGATGAAGCAGTAGTGACAACTGCACCACTGTATTCCCAACTTCTAAATGCTTTTGCTGAAGAAGCTACCCTAGAAGATGCTATTTATTACATGGGTGAAGCTCTGCGGAAGGAAGTTATAGATTTGGACACATTTTTGAAGCAAGTCCGCACATTGGCACGTCGACAGTTTACACTAAGGGCATTGATGCATAAATGCAGGCAAAAGGCTCAGTTAGCTTGCTAA

Protein

MTNHEAVLKQLLSKYKHRDFTSREVINLLQVYRSLTYRLEAFIFNNGSRKELLNIEGTIPVNYKGAFYNIPVSIWLMDTHPQNAPLCFVKPTSDMSIKVSKYVDTNGKVYLPYLHEWSSNSSTLKNLVQCMITAFGELPPVYSKPRNVAMPMFAAKPFMPESSGYPLPMPTPGYPTTTPYPTTSSLPYPNYGSPYPGTASTNGLPYPPAPITTPYPPASQYGPSTEGAGGTITEEHIKASLLSAVEDKLRRRLKEQSQQSQAELETLRRTQQELGEGKSRIEDIITRLQRERSELDKNVMILQEKEKELQAAVERLADQEGVDVDEAVVTTAPLYSQLLNAFAEEATLEDAIYYMGEALRKEVIDLDTFLKQVRTLARRQFTLRALMHKCRQKAQLAC

Description

Component of the ESCRT-I complex, a regulator of vesicular trafficking process. Binds to ubiquitinated cargo proteins and is required for the sorting of endocytic ubiquitinated cargos into multivesicular bodies (MVBs). Mediates the association between the ESCRT-0 and ESCRT-I complex. Required for completion of cytokinesis; the function requires CEP55. May be involved in cell growth and differentiation. Acts as a negative growth regulator. Involved in the budding of many viruses through an interaction with viral proteins that contain a late-budding motif P-[ST]-A-P. This interaction is essential for viral particle budding of numerous retroviruses. Required for the exosomal release of SDCBP, CD63 and syndecan (PubMed:22660413). It may also play a role in the extracellular release of microvesicles that differ from the exosomes (PubMed:22315426).

Subunit

Component of the ESCRT-I complex (endosomal sorting complex required for transport I) which consists of TSG101, VPS28, a VPS37 protein (VPS37A to -D) and MVB12A or MVB12B in a 1:1:1:1 stoichiometry (PubMed:18005716). Interacts with VPS37A, VPS37B and VPS37C (PubMed:15218037, PubMed:15509564). Interacts with DMAP1 (PubMed:10888872). Interacts with ubiquitin (PubMed:11595185). Interacts with stathmin, GMCL and AATF (By similarity). Component of an ESCRT-I complex (endosomal sorting complex required for transport I) which consists of TSG101, VPS28, VPS37A and UBAP1 in a 1:1:1:1 stoichiometry (PubMed:21757351). Interacts with HGS; the interaction mediates the association with the ESCRT-0 complex. Interacts with GGA1 and GGA3 (PubMed:15143060, PubMed:15039775). Interacts (via UEV domain) with PDCD6IP/AIP1 (PubMed:14505570, PubMed:14519844). Interacts with VPS28, SNF8 and VPS36 (PubMed:14505570). Self-associates (PubMed:14505570, PubMed:14519844). Interacts with MVB12A; the association appears to be mediated by the TSG101-VPS37 binary subcomplex. Interacts with VPS37D. Interacts with LRSAM1. Interacts with CEP55; the interaction is required for cytokinesis but not for viral budding (PubMed:17853893). Interacts with PDCD6 (PubMed:18256029). Interacts with LITAF (PubMed:23166352). Interacts with MGRN1 (PubMed:17229889). Interacts with ARRDC1; recruits TSG101 to the plasma membrane (PubMed:21191027, PubMed:22315426).
(Microbial infection) Interacts with HIV-1 p6.
(Microbial infection) Interacts with human spumavirus Gag.
(Microbial infection) Interacts with HTLV-1 Gag.
(Microbial infection) Interacts with Ebola virus VP40.
(Microbial infection) Interacts with EIAV p9; the interaction has been shown in vitro.
(Microbial infection) Interacts with Lassa virus protein Z.
(Microbial infection) Interacts with hepatitis E virus protein ORF3.

Similarity

Belongs to the ubiquitin-conjugating enzyme family. UEV subfamily.

Keywords

3D-structure   Acetylation   Alternative splicing   Cell cycle   Cell division   Coiled coil   Complete proteome   Cytoplasm   Cytoskeleton   Endosome   Growth regulation   Host-virus interaction   Membrane   Nucleus   Phosphoprotein   Polymorphism   Protein transport   Reference proteome   Transport   Ubl conjugation  

Feature

chain  Tumor susceptibility gene 101 protein
splice variant  In isoform 2.
sequence variant  In dbSNP:rs34385327.

Uniprot

A0A2A4JPS1   A0A1E1WLK1   A0A1V0JHU5   A0A0L7LM77   A0A194R3P8   A0A194QCS8   + More
H9J3P9   V9IJQ0   A0A2A3E0U5   A0A2J7RDC7   A0A088A8G9   A0A212FP45   A0A026WXG7   A0A151X6V4   V5IA93   A0A195EGD8   A0A1L8EDD6   A0A195FF75   E2AZS6   U5EZQ5   D3TNE1   A0A0L7QSC2   A0A034WB09   A0A195AWK8   A0A182MA76   W8CB77   A0A195CCW6   A0A1A9ZU67   A0A1A9V3W5   A0A1A9W4A6   B4KZ07   A0A182Q067   A0A0K8WKT9   A0A0M9A6L5   B4LE79   A0A182WKR6   A0A0M4F1U6   A0A1Q3FE78   A0A3B0KNR9   W8C786   A0A182NIP5   A0A182JNM1   B3NDH1   A0A1C7CZF1   A0A1Y9GL68   Q7Q6B6   A0A1Y1K7W7   A0A182JGT1   A0A182S6Z9   A0A182THL7   A0A1J1I6S8   B4H4C4   Q16LW0   A0A1S4FWC1   B0WII4   A0A182X6Z6   A0A182VKZ5   A0A1I8M8H1   A0A023ERB3   A0A182G9Q0   A0A1I8PKF7   A0A182GPL4   A0A310SS95   D6WIH5   A0A1B6CLS7   B3M4D5   A0A182RZR1   A0A0A1XCQ7   A0A182YD34   A0A232EJM5   A0A182FCA5   A0A1B6LBT4   A0A336KYH5   A0A336L0Q4   A0A0A9WFR4   A0A1B6GN30   A0A2K5C4J4   A0A2K5S838   F6YJ85   A0A067RQG0   A0A2K6UNI7   A0A2J8UQP2   A0A2K6DP04   G3R4B1   G1S7V5   A0A2K5ZAD9   A0A0D9QYD5   A0A2R9AQ37   A0A2I3N4L1   A0A2K6NCD4   G7PQL3   G7NDS4   A0A2I3SDN5   Q99816   A0A2K5I652   H9FZ74   A0A1B6JWT1   K7C918   F6ZA94   I0FUS3  

Pubmed

26227816    26354079    19121390    22118469    24508170    30249741    + More
20798317    20353571    25348373    24495485    17994087    20966253    12364791    14747013    17210077    28004739    17510324    25315136    24945155    26483478    18362917    19820115    25830018    25244985    28648823    25401762    26823975    25243066    24845553    22398555    22722832    25362486    22002653    17431167    16136131    9019400    9867424    15489334    9366528    9242438    9840940    10888872    11595185    11427703    11916981    14505570    12900394    12559917    14581525    12802020    14519844    15256501    15218037    15143060    15039775    15509564    15858022    16571837    18005716    17853893    17229889    17556548    18256029    19413330    19520058    19703557    21269460    21757351    21068219    21191027    23166352    22660413    22814378    22315426    23186163    25944712    12006492    12379843    15053872    16552148    21070952    21643473    25319552    19892987   

EMBL

NWSH01000825    PCG74001.1    GDQN01003170    JAT87884.1    KY694528    ODYU01009243    + More
ARD08869.1    SOQ53520.1    JTDY01000654    KOB76316.1    KQ460949    KPJ10466.1    KQ459185    KPJ03224.1    BABH01021730    JX569222    AFW03817.1    JR050819    AEY61358.1    KZ288470    PBC25338.1    NEVH01005291    PNF38832.1    AGBW02003976    OWR55479.1    KK107078    QOIP01000011    EZA60436.1    RLU17272.1    KQ982476    KYQ56064.1    GALX01001585    JAB66881.1    KQ978957    KYN27303.1    GFDG01002061    JAV16738.1    KQ981636    KYN38872.1    GL444277    EFN61055.1    GANO01000351    JAB59520.1    EZ422943    ADD19219.1    KQ414758    KOC61543.1    GAKP01007063    JAC51889.1    KQ976725    KYM76633.1    AXCM01008814    GAMC01000694    JAC05862.1    KQ978023    KYM98061.1    CH933809    EDW17804.1    AXCN02000418    GDHF01000568    JAI51746.1    KQ435724    KOX78305.1    CH940647    EDW69035.1    CP012525    ALC44982.1    GFDL01009174    JAV25871.1    OUUW01000012    SPP87506.1    GAMC01000692    JAC05864.1    CH954178    EDV52033.1    APCN01000100    AAAB01008960    EAA11918.4    GEZM01095070    JAV55526.1    CVRI01000043    CRK96015.1    CH479208    EDW31239.1    CH477889    EAT35314.1    DS231949    EDS28507.1    GAPW01001883    JAC11715.1    JXUM01154663    KQ572013    KXJ68089.1    JXUM01078851    KQ563092    KXJ74490.1    KQ761005    OAD58412.1    KQ971334    EEZ99668.1    GEDC01022874    JAS14424.1    CH902618    EDV40429.1    GBXI01006049    JAD08243.1    NNAY01003963    OXU18570.1    GEBQ01018837    JAT21140.1    UFQS01001240    UFQT01001240    SSX09883.1    SSX29606.1    UFQS01000770    UFQT01000770    SSX06750.1    SSX27095.1    GBHO01039909    GBHO01039908    GBRD01011388    GDHC01020427    JAG03695.1    JAG03696.1    JAG54436.1    JAP98201.1    GECZ01005958    JAS63811.1    GAMT01001463    GAMT01001462    GAMS01002450    GAMR01007290    GAMQ01003838    GAMP01007994    JAB10398.1    JAB20686.1    JAB26642.1    JAB38013.1    JAB44761.1    KK852528    KDR21984.1    NDHI03003449    PNJ47587.1    CABD030077714    CABD030077715    CABD030077716    CABD030077717    ADFV01112683    ADFV01112684    ADFV01112685    ADFV01112686    ADFV01112687    ADFV01112688    AQIB01085129    AQIB01085130    AQIB01085131    AQIB01085132    AJFE02062316    AJFE02062317    AJFE02062318    AJFE02062319    AJFE02062320    AJFE02062321    AHZZ02006885    AHZZ02006886    AHZZ02006887    AHZZ02006888    AQIA01020876    CM001289    EHH56403.1    JSUE03012634    JSUE03012635    CM001266    EHH23052.1    AACZ04016563    GABC01010505    GABF01004794    GABD01003086    NBAG03000219    JAA00833.1    JAA17351.1    JAA30014.1    PNI79014.1    U82130    BC002487    JU336180    JU477035    AFE79933.1    AFH33839.1    GECU01004056    JAT03651.1    GABE01005673    JAA39066.1    JV048128    AFI38199.1   

Proteomes

UP000218220    UP000037510    UP000053240    UP000053268    UP000005204    UP000242457    + More
UP000235965    UP000005203    UP000007151    UP000053097    UP000279307    UP000075809    UP000078492    UP000078541    UP000000311    UP000053825    UP000078540    UP000075883    UP000078542    UP000092445    UP000078200    UP000091820    UP000009192    UP000075886    UP000053105    UP000008792    UP000075920    UP000092553    UP000268350    UP000075884    UP000075881    UP000008711    UP000075882    UP000075840    UP000007062    UP000075880    UP000075901    UP000075902    UP000183832    UP000008744    UP000008820    UP000002320    UP000076407    UP000075903    UP000095301    UP000069940    UP000249989    UP000095300    UP000007266    UP000007801    UP000075900    UP000076408    UP000215335    UP000069272    UP000233020    UP000233040    UP000008225    UP000027135    UP000233220    UP000233120    UP000001519    UP000001073    UP000233140    UP000029965    UP000240080    UP000028761    UP000233200    UP000009130    UP000233100    UP000006718    UP000002277    UP000005640    UP000233080    UP000002281   

PRIDE

H9J3P9    Q99816   

Pfam

PF05743   UEV        + More
PF09454   Vps23_core
PF05251   Ost5

Interpro

IPR008883   UEV_N        + More
IPR016135   UBQ-conjugating_enzyme/RWD       
IPR017916   SB_dom       
IPR037202   ESCRT_assembly_dom       
IPR007915   TMEM258/Ost5       

SUPFAM

SSF54495   SSF54495        + More
SSF140111   SSF140111       

Gene 3D

3.10.110.10    

ProteinModelPortal

A0A2A4JPS1   A0A1E1WLK1   A0A1V0JHU5   A0A0L7LM77   A0A194R3P8   A0A194QCS8   + More
H9J3P9   V9IJQ0   A0A2A3E0U5   A0A2J7RDC7   A0A088A8G9   A0A212FP45   A0A026WXG7   A0A151X6V4   V5IA93   A0A195EGD8   A0A1L8EDD6   A0A195FF75   E2AZS6   U5EZQ5   D3TNE1   A0A0L7QSC2   A0A034WB09   A0A195AWK8   A0A182MA76   W8CB77   A0A195CCW6   A0A1A9ZU67   A0A1A9V3W5   A0A1A9W4A6   B4KZ07   A0A182Q067   A0A0K8WKT9   A0A0M9A6L5   B4LE79   A0A182WKR6   A0A0M4F1U6   A0A1Q3FE78   A0A3B0KNR9   W8C786   A0A182NIP5   A0A182JNM1   B3NDH1   A0A1C7CZF1   A0A1Y9GL68   Q7Q6B6   A0A1Y1K7W7   A0A182JGT1   A0A182S6Z9   A0A182THL7   A0A1J1I6S8   B4H4C4   Q16LW0   A0A1S4FWC1   B0WII4   A0A182X6Z6   A0A182VKZ5   A0A1I8M8H1   A0A023ERB3   A0A182G9Q0   A0A1I8PKF7   A0A182GPL4   A0A310SS95   D6WIH5   A0A1B6CLS7   B3M4D5   A0A182RZR1   A0A0A1XCQ7   A0A182YD34   A0A232EJM5   A0A182FCA5   A0A1B6LBT4   A0A336KYH5   A0A336L0Q4   A0A0A9WFR4   A0A1B6GN30   A0A2K5C4J4   A0A2K5S838   F6YJ85   A0A067RQG0   A0A2K6UNI7   A0A2J8UQP2   A0A2K6DP04   G3R4B1   G1S7V5   A0A2K5ZAD9   A0A0D9QYD5   A0A2R9AQ37   A0A2I3N4L1   A0A2K6NCD4   G7PQL3   G7NDS4   A0A2I3SDN5   Q99816   A0A2K5I652   H9FZ74   A0A1B6JWT1   K7C918   F6ZA94   I0FUS3  

PDB

4YC1     E-value=1.59341e-47,     Score=478

KEGG

101743249    K12183 ESCRT-I complex subunit TSG101 | (RefSeq) Vps23; tumor susceptibility gene 101 protein

PATHWAY

04144    Endocytosis - Bombyx mori (domestic silkworm)

GO

GO:0015031   GO:0006464   GO:0006487   GO:0034998   GO:0016021   GO:0036258   GO:0035090   GO:0016322   GO:0000813   GO:0044130   GO:0045571   GO:0005886   GO:1903551   GO:0044877   GO:2000397   GO:0070062   GO:0003714   GO:0030216   GO:0007175   GO:0008285   GO:0043162   GO:0005770   GO:0006858   GO:0042803   GO:0045892   GO:1990182   GO:0005829   GO:0046755   GO:0001558   GO:1903774   GO:0043405   GO:0046790   GO:0043130   GO:1902188   GO:0007050   GO:0031625   GO:0005769   GO:0048306   GO:0005730   GO:1903543   GO:0005737   GO:0042059   GO:0016236   GO:0005815   GO:0090543   GO:0005768   GO:0003677   GO:0030374   GO:0005771   GO:0010008   GO:0097352   GO:0019058   GO:0031901   GO:0008333   GO:0039702   GO:0051301   GO:0016197   GO:0075733   GO:0031902   GO:0043657   GO:0006513   GO:0006412   GO:0007264   GO:0006468   GO:0006811   GO:0016020   GO:0043564   GO:0006418   GO:0003824  

Subcellular location

Cytoplasm   Mainly cytoplasmic. Membrane-associated when active and soluble when inactive. Nuclear localization is cell cycle-dependent. Interaction with CEP55 is required for localization to the midbody during cytokinesis.   With evidence from 34 publications.
Early endosome membrane   Mainly cytoplasmic. Membrane-associated when active and soluble when inactive. Nuclear localization is cell cycle-dependent. Interaction with CEP55 is required for localization to the midbody during cytokinesis.   With evidence from 34 publications.
Late endosome membrane   Mainly cytoplasmic. Membrane-associated when active and soluble when inactive. Nuclear localization is cell cycle-dependent. Interaction with CEP55 is required for localization to the midbody during cytokinesis.   With evidence from 34 publications.
Cytoskeleton   Mainly cytoplasmic. Membrane-associated when active and soluble when inactive. Nuclear localization is cell cycle-dependent. Interaction with CEP55 is required for localization to the midbody during cytokinesis.   With evidence from 34 publications.
Microtubule organizing center   Mainly cytoplasmic. Membrane-associated when active and soluble when inactive. Nuclear localization is cell cycle-dependent. Interaction with CEP55 is required for localization to the midbody during cytokinesis.   With evidence from 34 publications.
Centrosome   Mainly cytoplasmic. Membrane-associated when active and soluble when inactive. Nuclear localization is cell cycle-dependent. Interaction with CEP55 is required for localization to the midbody during cytokinesis.   With evidence from 34 publications.
Midbody   Mainly cytoplasmic. Membrane-associated when active and soluble when inactive. Nuclear localization is cell cycle-dependent. Interaction with CEP55 is required for localization to the midbody during cytokinesis.   With evidence from 34 publications.
Midbody ring   Mainly cytoplasmic. Membrane-associated when active and soluble when inactive. Nuclear localization is cell cycle-dependent. Interaction with CEP55 is required for localization to the midbody during cytokinesis.   With evidence from 34 publications.
Nucleus   Mainly cytoplasmic. Membrane-associated when active and soluble when inactive. Nuclear localization is cell cycle-dependent. Interaction with CEP55 is required for localization to the midbody during cytokinesis.   With evidence from 34 publications.

Length:

398

Number of predicted TMHs:

0

Exp number of AAs in TMHs:

0.03198

Exp number, first 60 AAs:

0.01388

Total prob of N-in:

0.02095

outside

1  -  398

 

 

Pi

192.983239

Theta

221.566371

Tajima's D

-0.354765

CLR

1.395168

CSRT

0.27763611819409

Interpretation

Uncertain