SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11677
Pre Gene Modal
BGIBMGA003979
Annotation
S33901_reverse_transcriptase_-_silkworm_transposon_Pao
Location in the cell
Nuclear   Reliability : 2.23
 

Sequence

CDS
ATGGCGTCACCGCAAGACTGTTTGTATATTTCTTTACTTGGTTTAGCGGAACATTTTCGAACTTCTAATCCCCCTGACATAAAAAGTTGTATCCAGTGCTTACAAGCTGTGTTTAATTTTAATCCGCCAGCAAGGGTAGAAGCCAGGACTCATTTACAACTCGGTAATATACTTTTGACACACACCAAAAACATCGACTTGGCGAGAACGCACTTAGAGCAAAGTTGGTGCTTATCACAAACTACAAATGCTTTAGACGAGTTCAAGTTCGAGGCAGCTAGCGTTCTTGCTGAGCTATTTGAGCAGCAAGGTCAACCTGCACATTCTAAACCAATTCTAAGGAAAGCAATAGAGTTATCACAACATAGTGTATATTGGCATTGTAGACTCATTTTTCAACTGGCTCAAATACATGCTACAGAGAAAGAGTATGAAGTGGCCAGTAGTCTACTTGGTGTTGGTGTGGATTATGCACAAATATCAAATGTGGCATATACACAAGTACTGTTCTTGTTAAGTAGGGTAATGTTATTATTAATAGATAAGAAAATTCAAGAAGTGTTACCATTATTAAATCAAGCTGGACATTTAGTAGATTCTTGGACAGGAAGAGGTCGGATCGAAACTAAACAATCGCCGCCCTCAGAAACCACAGCTACAATACAGAGCGTGTGGACAGAAACAACCGCGAATACCGTCATGAGTCTGGTAGCCCCCACAGCAGAATCATCGTGCGCAACAGCCAACATGGAAGCCACGATGAAAGTCGCAGAGAAACCTGGGAACTCAAAAACAGAGGCCGTCAAACAGTATATAGCCAAACAGAATGACGTGCCAACAAAACAGCGCGCCGGTACAGTCAAAACTGACCGGTCGCGAAACAGAAAAGAACAGAAGATAGCCAAAGCTAGAGAAGAGCTCGCCCGCCTACAGGTGGAGTTAGCAGCCGCCCGATTGGCCACGCTCGAAGCTGGATCTGATGACGAAAACAGCGAATCAGAATACAGTAAGTCAGAACTCGACGAAAGAGTGGGCACGTGGTTGGAAACGCAACCCACAAAAATGGAAAATCACGACCGACATAAGGAAACACCGGCGGGAGCCTGCGACAAACAAGACTTCTCAGATCTAACCGCAGCAATAACACTCGCCGTCAAAGCCGCCCGCGAACCAAGATACACAGAATTGCCATTCTTTAATGGAAATCACCAAGACTGGCTATCCTTTCGTGCAGCCTATCACGAGACGATGAATTCATTTACAAAAACAGAAAATATAAACAGACTCAGAAGGAACCTGAAAGGAAGGGCAAAGGAAGCCGTTGACGGATTACTTATAACGAACGCTGATCCGTCCGACGTCATAAGAAGTCTAGAAGCGCGATTCGGAAGACCGGAAACAATAGCCATAACGGAGTTAGACACGCTACGAGCTCTGCCAAGACTAACAGAAACACCAAGAGACATTTGTATATTCTCCAGTAAGGTGACCAACGCCGTAGCTACGCTTCGTGCATTAAATTGCACACATTACTTATATAATCCGGAAACTACCAAAACAATGTTAGAAAAACTCACACCAACACTACGTTACCGATACTACGACTTCACCGCGATACAACCGAAGGAGGATCCGGATCTGATTAAATTTGAAAAATTCATGAAAAGAGAAGCCGAACTGTGCAGCCCTTATGCACAGCCTGAACAGGTGGGGCACTACTCGCAGCCCGCACAACATAACAGACGCACACAAAACGTGCACATAGTCAGTGAGAAGCCATCACGAGCTAAATGTCCGGTATGTAGCAACACTGAACACACCACAACAGACTGCTACATATTCAAGAAGGCAGACTCAAACACAAGATGGGATATCGCTAAGAATAAACACCTGTGTTTCCGATGTCTCAAGTATAGAAATAAAACCCACCACTGTAAACCGAAGACGTGTGGCATTAATGATTGCAAATATACTCACAACAAGATGCTACACTTCGACAGAAAAATTGAAAAAACAGACAAGAGTGACAAGGAAACAACAGAGAACATTAATTCCGCTTGGACCGGAAAACAGAAACAGTCCTATTTGAAAATAATCCCAGTCCAAGTACAAGGACCGATAGGCACGGTTGATACATACGCGCTGCTCGACGATGGATCAACGGTGACACTCATAGACGAAATCATTTGCAAGAAGACTGGAATAACAGGACCAATCGATCCGTTACACATACAGGCGATTAACAACATAAAATCAACGGAAACAAGGTCAAGAAGAGTCAACCTCACGCTCAGAGGCCTCAACAGTCGAAAAGAAATAATACAAGCGAGAACAGTTAACGACCTACAAGCAACAGCACAAAAAATACCAAAGGAACAGATAGATGAGTATTCGCACCTACGAGACATCAGTGACATCATCACGTACGAGAACGCGAAACCTGGAATCCTGATTGGCCAAGACAACTGGCACATGTTACTAACTTCAAAAGTTAGACGAGGCAACAGGAATCAGCCAATAGCGTCACTGACACCTCTAGGCTGGGTATTGCATGGAGGTCGCACTCGTACCCTAGGCCACCACATAAACTACATAAATCATGCTAGCGAAACCCAAGAAGATGATAAAATAGAAAATCTGATAAAACAGTATTTCGCTATGGATGCGCTATGCATCACACCAAGAAAACCAAAAACAGACCCAGAGGAACAGGCGCTTCGCATCCTCAACAGCAATACAGTCCACACAACAGATGGAAGATACGAAACTGCTCTGCTCTGGAAAACAGATAATGTCAGTCTACCAGACAACTACAATAACTCGTTAAAGCGACTGATAAATATAGAAAACAAACTCGATCGTAATCCGGAACTGAAACAGAAATACACAGAACAGATGGAAGCACTCGTCGCGAAAAGCTACGCCGAGCCCGCTCCAAAAACAAAAACAGAGAACAGAACGTGGTATCTACCTCACTTCGCCGTCGTGAACCCCCTGAAGCCGGAAAAACTCCGAGTCGTCCACGACGCCGCCGCCAGAACAAGAGGGGTAGCTTTGAATGATATGCTGCTTAAGGGACCGGACCTACTCCAATCACTACCAGGAGTGATAATGCGATTTAGACAGCATAATATAGCAGTAACAGCAGACATCAAGGAGATGTTAATGCAAGTGAAATTAAGACATGAAGACAGAGACGCGCTCCGTTATCTCTGGCGCAAAGATCAGCGAGATGACAAGCCCCCAGAAGAAAACAGAATGACCTCGTTGATCTTCGGGGCGTCAAGTTCTCCTTCCACAGCAATGTATGTAAAGAACTTGACCGCCCAGAAACAAGAAGCCACGCACCCGGAGGCGGCAGTCGCAGTACAGAACAGACACTACGTCGACGACTACTTGAACAGCTTCAAAAGTTTAAAAGTACACACAACTACAGACTTTCGTCGAAAACACGAAAGAAAACCGACCTCGAAGACCTTCTGGACCGACAGTAAGATAGTGTTGAGACGGACAAGGACGGGATCACGCTCGTACAAACCTTACGTCACCCAACGCCTGACAGCTATAGAAGACAGTGCAACAGTATGTCACTACCTTATGGCAGGACAGGTGAAGAGTGTGAAGCCATGTCTAAAGCAACTGCAACAGAGCATACAGACAATAATGGCACCGACATGGCCTGATGATGATGCTGTGTGCGGTACGGTTCCCGGCGAGTCGTTCATCTGGTTGTCGCGACAGCAGCTGTACGTCCTCGTGTACCTGGTCACAGTGATGCATTCAGCACAAGCCGGCTACATGGACAAGGCGCACAAGTACACAGAAAAGGCTCTAGCACAGATTGATAAACTTACTTCGAGCGCGGGCGAGGAGGCTGGCGGCGCGGAGCGGCAGTCCCGCGGCGCGACGCTGGCGTGGCGGCTGCGCATGGCGCTGGTGGAGCACGCGGCGCTGTGCCGCCTCGTGGCCGGCGGCAAGGCGCACGCGCTCAACGAGATCGCACGCGCCGCGCACCTGCTCACCGTCGCGCCCACGCGTACGTATCCGCATCTAATAATAGGCTTTTGA
Protein
MASPQDCLYISLLGLAEHFRTSNPPDIKSCIQCLQAVFNFNPPARVEARTHLQLGNILLTHTKNIDLARTHLEQSWCLSQTTNALDEFKFEAASVLAELFEQQGQPAHSKPILRKAIELSQHSVYWHCRLIFQLAQIHATEKEYEVASSLLGVGVDYAQISNVAYTQVLFLLSRVMLLLIDKKIQEVLPLLNQAGHLVDSWTGRGRIETKQSPPSETTATIQSVWTETTANTVMSLVAPTAESSCATANMEATMKVAEKPGNSKTEAVKQYIAKQNDVPTKQRAGTVKTDRSRNRKEQKIAKAREELARLQVELAAARLATLEAGSDDENSESEYSKSELDERVGTWLETQPTKMENHDRHKETPAGACDKQDFSDLTAAITLAVKAAREPRYTELPFFNGNHQDWLSFRAAYHETMNSFTKTENINRLRRNLKGRAKEAVDGLLITNADPSDVIRSLEARFGRPETIAITELDTLRALPRLTETPRDICIFSSKVTNAVATLRALNCTHYLYNPETTKTMLEKLTPTLRYRYYDFTAIQPKEDPDLIKFEKFMKREAELCSPYAQPEQVGHYSQPAQHNRRTQNVHIVSEKPSRAKCPVCSNTEHTTTDCYIFKKADSNTRWDIAKNKHLCFRCLKYRNKTHHCKPKTCGINDCKYTHNKMLHFDRKIEKTDKSDKETTENINSAWTGKQKQSYLKIIPVQVQGPIGTVDTYALLDDGSTVTLIDEIICKKTGITGPIDPLHIQAINNIKSTETRSRRVNLTLRGLNSRKEIIQARTVNDLQATAQKIPKEQIDEYSHLRDISDIITYENAKPGILIGQDNWHMLLTSKVRRGNRNQPIASLTPLGWVLHGGRTRTLGHHINYINHASETQEDDKIENLIKQYFAMDALCITPRKPKTDPEEQALRILNSNTVHTTDGRYETALLWKTDNVSLPDNYNNSLKRLINIENKLDRNPELKQKYTEQMEALVAKSYAEPAPKTKTENRTWYLPHFAVVNPLKPEKLRVVHDAAARTRGVALNDMLLKGPDLLQSLPGVIMRFRQHNIAVTADIKEMLMQVKLRHEDRDALRYLWRKDQRDDKPPEENRMTSLIFGASSSPSTAMYVKNLTAQKQEATHPEAAVAVQNRHYVDDYLNSFKSLKVHTTTDFRRKHERKPTSKTFWTDSKIVLRRTRTGSRSYKPYVTQRLTAIEDSATVCHYLMAGQVKSVKPCLKQLQQSIQTIMAPTWPDDDAVCGTVPGESFIWLSRQQLYVLVYLVTVMHSAQAGYMDKAHKYTEKALAQIDKLTSSAGEEAGGAERQSRGATLAWRLRMALVEHAALCRLVAGGKAHALNEIARAAHLLTVAPTRTYPHLIIGF

Summary

Uniprot
Pfam
PF03564   DUF1759
Interpro
IPR005312   DUF1759       
ProteinModelPortal

Ontologies

Topology

Length:
1355
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.3984
Exp number, first 60 AAs:
0.00049
Total prob of N-in:
0.00328
outside
1  -  1355
 
 

Population Genetic Test Statistics

Pi
145.862353
Theta
113.519313
Tajima's D
0.785489
CLR
0.083976
CSRT
0.60101994900255
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号