SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11651  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA003996
Annotation
hexosaminidase_[Danaus_plexippus]
Full name
Beta-hexosaminidase       + More
Probable beta-hexosaminidase fdl      
Alternative Name
Protein fused lobes
Location in the cell
Cytoplasmic   Reliability : 1.438 PlasmaMembrane   Reliability : 1.036
 

Sequence

CDS
ATGTTGTGTGCAGGAGGTCAAATTTGGCCTCAACCAAGGGGAGCGATCAGCCTTTCCACAACCGCTGTGCCAGTACACGCTGACTCTTTCAGATTGAAAATATTATTAACTCCATCCCGTACGGTTCAAGAATATCTACAAGAGTCCTTTGAATTATTTCGGGAAGATGTTAAAAGACTCGAACAGTCAGCATTTGGTTTCGAAGAGCGGCGAAGTGTACTCGTCCGGATTGCCATAAATGGTAGTGAAGATCCACGAATGCGTATAGATACTGAAGAAAACTACAAACTTGTAATTCGCCCTAATTCCGATGACGGTTTGATGCTCGTAGATATATCTGCATCTACGTTCTGTGGTGCACGTCATGGCTTAGAAACTTTAATACAATTAATATGGTTTGATCCTTACGTCGCATCACTGTTTATGCTAGAAGCTGCATCAGTTGACGATTCGCCTCGATTCAAATACCGGGGGCTGTTATTAGACACAGCGCGTAATTATTTTCCGGTTCGTGATCTCATGCGAACTATTGATGGTATGGCCATTTCTAAGCTTAACACCTTTCACTGGCATGTAACCGATACCCAAGCATTCCCTTTACAATTAGACAGTGTAAAACATTTATCAAAACGAGGAGCCTACAGTCTGAGAGATGTTTACACAAAAGATGACGTCAGAGCATTAGTGCATCGTGCGAGATTACGTGGGATACGAGTTCTGATAGAAATAGATGTACCATCTCATGTTGGTCCAACCTGGAGTTTCAGTTCAGATTCGGAAACTGATGATCTTTCTTTATGTACCAACGCTCAACCTTGGAGTCCATTATGTCATGAGCCTCCTTGTGGGCAATTAAATCCACGAAACACTGATTTGTTTTTACTTTTAGAGCAAGTTTTTACAGAAATCATCCAGCTCACTGGAGTCGATGATTTGTTTCACATGGGAGGCGACGATGTGTCACTAGAATGTTGGGAACATTATTTCAATGATACTAACAGTGAAAACTATTTGATAGAATTTACCCGGTCTTCGTTAGATCGGCTACGCTATGTCAATGGCCGATTACCCAATCTAACATTATTTTGGTTTTCTTCCATAAGCGACCGTATCAAGACTGATTTGAAAGAGTCCGCGGACTTTATAGGTTTGCAGTTACGAGAATTCACATGGAAACATAAGTCTATTAATGGAATACGAACAGTCATTTCACACGAAGACGCATGGGACCTGAATAATGGAATGGGAGCTTGGTATGACACTAATGGTGGTATCCCTTACAATTCATGGCAACATGTGTATGAACACCGGCCATGGGCGAAAGATGTCGCTAATATAGAAGGAGGGGAGGCAACAGTTTGGTCCTCGACTTTAAGTGATGATGATCTCGATGCCACGGTGTGGCCTAGGGCGGCTGCTTTAGCAGAAAGACTATGGACAGACCGTGCCGAAGGCGCGACCCGTCCGGTACATGCGAGGTTAGATTTGCATCGCTCTCGGTTGGTTGCGCGGGGTCTAAAAGCAGCACCTATATGGTCTATGTGGTGCACTCAAAACCCTTACACGTGTTAA
Protein
MLCAGGQIWPQPRGAISLSTTAVPVHADSFRLKILLTPSRTVQEYLQESFELFREDVKRLEQSAFGFEERRSVLVRIAINGSEDPRMRIDTEENYKLVIRPNSDDGLMLVDISASTFCGARHGLETLIQLIWFDPYVASLFMLEAASVDDSPRFKYRGLLLDTARNYFPVRDLMRTIDGMAISKLNTFHWHVTDTQAFPLQLDSVKHLSKRGAYSLRDVYTKDDVRALVHRARLRGIRVLIEIDVPSHVGPTWSFSSDSETDDLSLCTNAQPWSPLCHEPPCGQLNPRNTDLFLLLEQVFTEIIQLTGVDDLFHMGGDDVSLECWEHYFNDTNSENYLIEFTRSSLDRLRYVNGRLPNLTLFWFSSISDRIKTDLKESADFIGLQLREFTWKHKSINGIRTVISHEDAWDLNNGMGAWYDTNGGIPYNSWQHVYEHRPWAKDVANIEGGEATVWSSTLSDDDLDATVWPRAAALAERLWTDRAEGATRPVHARLDLHRSRLVARGLKAAPIWSMWCTQNPYTC

Summary

Description
Involved in brain restructurization via hormonal control during metamorphosis. Implicated in N-glycan processing.
Catalytic Activity
Hydrolysis of terminal non-reducing N-acetyl-D-hexosamine residues in N-acetyl-beta-D-hexosaminides.
Similarity
Belongs to the glycosyl hydrolase 20 family.
Keywords
Alternative splicing   Complete proteome   Developmental protein   Glycoprotein   Glycosidase   Hydrolase   Reference proteome   Signal  
Feature
chain  Beta-hexosaminidase
splice variant  In isoform B.
EC Number
3.2.1.52
EMBL
BABH01021684    NWSH01001413    PCG71313.1    AGBW02009781    OWR49928.1    ODYU01001276    + More
SOQ37272.1    KQ460949    KPJ10490.1    KQ459185    KPJ03250.1    JTDY01000705    KOB76153.1    GU984637    ADF97235.1    AGBW02005277    OWR55318.1    BABH01021699    BABH01021700    FJ695481    ACV89847.1    RSAL01000352    RVE42263.1    JTDY01001324    KOB74197.1    FJ695480    ACV89846.1    AB540233    BAJ20189.1    EU334747    ODYU01005953    ACA30398.1    SOQ47378.1    KPJ03244.1    JTDY01007043    KOB65498.1    FJ695479    ACV89845.1    NWSH01002205    PCG68909.1    KP000851    AJG44546.1    KPJ10484.1    EF592539    KQ971354    ABQ95985.1    EFA06836.2    BT127532    AEE62494.1    GEZM01019981    JAV89483.1    KB632326    ERL92397.1    GFDF01001338    JAV12746.1    AJWK01013083    AAAB01008807    EAA03943.4    LJIG01002462    KRT84478.1    CH479210    EDW32880.1    CM000071    KRT03108.1    OUUW01000001    SPP74050.1    KRT03107.1    EAL26439.2    KRT03109.1    SPP74049.1    CH902619    EDV35497.2    KPU75704.1    KPU75705.1    KPU75706.1    EDV35498.2    AXCM01013128    KPU75708.1    ATLV01023205    KE525341    KFB48585.1    CP012524    ALC40696.1    AXCN02000449    DS232017    EDS32008.1    CVRI01000043    CRK96298.1    CRK96299.1    PYGN01000845    PSN40104.1    JXUM01097258    JXUM01097259    JXUM01097260    JXUM01097261    APCN01000152    GFDL01013164    JAV21881.1    GFDL01013165    JAV21880.1    UFQT01001050    SSX28632.1    UFQS01000102    UFQT01000102    SSW99622.1    SSX20002.1    CH964154    EDW79791.2    JRES01000960    KNC26699.1    CM002911    KMY93226.1    KMY93227.1    CM000362    EDX06787.1    KMY93230.1    CM000158    KRJ99443.1    KRJ99444.1    KMY93229.1    EDW90752.2    CH480816    EDW47584.1    CH933808    EDW08100.1    KRG03902.1    CH940662    EDW58708.1    CH954179    KQS62831.1    KQS62830.1    AF323977    AE013599    AY113418    AY061037    AAL28585.1    AAL55992.1    AAM29423.1    CH916367    EDW01224.1    AHN56149.1    KRF78418.1    KRJ99445.1    AHN56148.1    BT133255    AFC17499.1    KRF78419.1    NNAY01000660    OXU27126.1   
Pfam
PF14845   Glycohydro_20b2        + More
PF00728   Glyco_hydro_20
PF01490   Aa_trans
Interpro
IPR029019   HEX_eukaryotic_N        + More
IPR015883   Glyco_hydro_20_cat       
IPR029018   Hex-like_dom2       
IPR025705   Beta_hexosaminidase_sua/sub       
IPR017853   Glycoside_hydrolase_SF       
IPR013057   AA_transpt_TM       
SUPFAM
SSF51445   SSF51445        + More
SSF55545   SSF55545       
Gene 3D
PDB
3S6T     E-value=9.08887e-78,     Score=740

Ontologies

Topology

Length:
523
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01394
Exp number, first 60 AAs:
0.00277
Total prob of N-in:
0.00108
outside
1  -  523
 
 

Population Genetic Test Statistics

Pi
63.621355
Theta
148.694248
Tajima's D
-0.916425
CLR
0
CSRT
0.152892355382231
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号