SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11623
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.197
 

Sequence

CDS
ATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTGTTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCTCCGCGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCGAGTAGAAATAAGTCCCTAATCGCAAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAA
Protein
MPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASVFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPGNRTRRTRQRGRRAT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KC165845    AFY12622.1    KQ459265    KPJ02064.1    AF081103    AAC72921.1    KQ459259    KPJ02068.1    AF081101    AAC72919.1    GEZM01008457    JAV94772.1    GALX01005359    JAB63107.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    KQ973342    KXZ75569.1    GGMR01019198    MBY31817.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02014862    ABLF02014866    ABLF02061908    ABLF02042518    ABLF02057746    ABLF02003961    ABLF02059872    ABLF02008933    GGMS01000737    MBY69940.1    GGMS01002955    MBY72158.1    GGMR01016114    MBY28733.1    ABLF02033757    GGMS01008766    MBY77969.1    GGMR01003407    MBY16026.1    KK117880    KFM71667.1    GGMR01018716    MBY31335.1    GBBI01004395    JAC14317.1    GEZM01038405    JAV81653.1    GGMR01000676    MBY13295.1    GBBI01001646    JAC17066.1    GGMS01004685    MBY73888.1    GFXV01007093    MBW18898.1    GGMS01006359    MBY75562.1    GGMS01012005    MBY81208.1    ABLF02008463    GGMS01017914    MBY87117.1    NEVH01006736    PNF36716.1    NEVH01020071    PNF21969.1    GEZM01053022    JAV74219.1    ABLF02020655    ABLF02039168    ABLF02061060    NWSH01000032    PCG80497.1    RPOV01000134    RPJ78669.1    GBBI01004571    JAC14141.1    NEVH01010546    PNF32261.1    ABLF02037660    NEVH01023962    PNF17612.1    ABLF02008153    ABLF02008462    ABLF02008464    NEVH01003017    PNF40781.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01018383    PNF23463.1    NEVH01007443    PNF35684.1    NEVH01000269    PNF43694.1    NEVH01002704    PNF41489.1    GBGD01000880    JAC88009.1    NEVH01020940    PNF20481.1    GFTR01008038    JAW08388.1    ABLF02034467    NEVH01005938    PNF38077.1    GBGD01000799    JAC88090.1    NEVH01006721    PNF37225.1    ABLF02021177    ABLF02027367    ABLF02066338    ABLF02024246    AY060438    AAL25477.1    NEVH01001355    PNF42855.1    NEVH01021205    PNF19912.1    NEVH01017542    PNF24034.1    NEVH01026386    PNF14434.1    NEVH01014858    PNF27387.1    NEVH01000280    PNF43672.1    NEVH01012089    PNF30491.1    NEVH01007838    PNF34986.1    NEVH01023961    PNF17613.1    NEVH01002716    PNF41415.1    NEVH01007393    PNF35987.1    GBBI01001570    JAC17142.1    NEVH01019964    PNF22161.1    AF012049    AAC24972.1    NEVH01007578    PNF35646.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    PCG80496.1    GGMS01017365    MBY86568.1    NEVH01006754    PNF36554.1    GGMR01014053    MBY26672.1    GFTR01008262    JAW08164.1    NEVH01011985    PNF31054.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GGMS01002992    MBY72195.1    S59870    AAB26437.2    NEVH01019376    PNF22596.1    NEVH01022639    PNF18527.1    GGMR01004661    MBY17280.1    LBMM01014395    KMQ85192.1    GFXV01006424    MBW18229.1    NEVH01019080    PNF22876.1    GBBI01001642    JAC17070.1    GGFJ01001857    MBW50998.1    GBGD01000881    JAC88008.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
579
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.64230000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.03028
outside
1  -  579
 
 

Population Genetic Test Statistics

Pi
21.064746
Theta
21.78309
Tajima's D
-0.124898
CLR
0
CSRT
0.338083095845208
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号