SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11603
Annotation
PREDICTED:_uncharacterized_protein_LOC106720812_[Papilio_machaon]
Location in the cell
Mitochondrial   Reliability : 1.233 Nuclear   Reliability : 1.627 PlasmaMembrane   Reliability : 1.132
 

Sequence

CDS
ATGCCGACAAACCCTGCGACTAGTTCTGGTGTGCAAGTTAATATTATACAACCTAGTACTTCCCAACATGTAGACAGCATTGCTCCGAGTGAGACGTCTAAGTCAAAATCATCACGCTCGTCATCCACAATTAAGGCTCAAAAGGCCGCCGTAGAGGCCCTCGCCCTGCGCCGACGTCTTGAGCACGAGCAGGAGCTGGCTGAACGTGAGAGGCAACGTGAAAGTCGACTGGCAGCACTCCGTCAGCAGGTAGAGGAGGGCGAACTGAAGGCCGAACTTGCCGCTCTCGACGCGGAAGCCGCGGCAAGTCACAGCAGTCGCAGTGGTTCTGCCAGGGTAAGCGTAGAAAGAACAGAAAGATGGGTACAAAGTTTAGGACAGCCAGTTTGCGTTGGCGAAAATACAGTTAATAGAGGCATCCCCGCAGTAGGGCGAGAGCAAGTATTGGTTCCGCCTCCCGGCCACCAGGCACCTCTGCCGGCCACTGGGTCAACTGCATCCCCTGTTAACCGTTTTGTTCATCAGAAACAAGTTTTAAACGTCACTAAAGCGTCCGAGGCGGCCGTACTTACGCGACCGCTCATTTCCACGGAGGTTGATCAGAGTAGTCTGCTTCAGGCTGTTGCTGACACTGCAGCTGCGGCCAAGGCGCTTGCTACTTCGCACCGTCATAAACATAAGATCGAATTGTTTCCTTTCGACGGAGACGCCTTAACATGGCTACATTTTAAACGTATTTTTGATTTAACCAAAAACAATTTTTCAAATATTGAAAATATTAGTCGGTTACAAAATGCACTTCGCGGCGCGGCCCGAGATGCAGTCGCGTCACTGTTGCTGGCTACAGACAACCCGAACGATATTATAAGAGCTCTGGAGGAGAACTTCGCTCGCCCGGAAATTATAGTATTTAAGGAAGTCTCCGCTCTTAAAAATCTACCACGTTTGGGAAATGACTTGAAAGAGTTAATTACGATAACGAATAAGGTACGTAATTCTATATCTTCTTTTAAAATACTGAATCAAATTGAGTACTTGCATTCTCCAGAACTATTTCACGCCGTCTTAGGAAAATTAAACCCGGTTACTAAAGTAAGATGGACGGACTTTGCTATGCAAGATACTACAGGGCGTCCTAAATTAGAAATTATGTCCGATTTTTTGAGGCGCGAGTTAGATCAACTTATTCGGTTCGGTTTATCACCGGAATCTTGCTCGATCCAACATTCACCACAAAATACTCATCTAAACAAACCGTATAAACGGGAAAATATTCACATAGTTACACACTCTAAACAAAATTCTAAGGCGGCGTCTACACAAAAGCTTGAATGCGCGTTTTGCAAAAAAGATCACAATATTAAGTCATGTTCTGAGTTCAAAGCCTTATCTGTTGATGAAAGGTGGGTCTGGCTGCGTGAGGTAAAAGCGTGTTATAGATGTCTTAGGCGTAGTTCACATCAGTGGAAAACATGTAAAGTTAACCCTTGTGGTGTTGATGGGTGTCTAATACGTCATCACCCGTTAATGCATGGTAAAGAACCTGCCTCTTCTGTCAATACTATGTTCGACACGCAATCCACCGAAAATGATCATACGACTAAGCACCACGAACCTGCATCTGTCGAAAAGGTAATAGTTTCTACCACTTCTACAGGTGTTCAAGAACCCAGCTCCATCTTAACTCTGTGCCCACGTGTATTTCTGAAAATCTTACCCGTTACTGTCTCTGGTCCCTCAGGAAGTTGCAATGTTTACGCACTTCTCGATGACGGTAGCACTGCTACGCTCATTGACTCAAGTATTGCTACTCAAATCGGTGCGACAGGGCCTCACCAGAAAATAACGGTTAATGGTATAGGCGGTCTCAGTAGAAACGCTACGATATCGTATGTAGATTTTCACATTAAGGGTAGGCACACACGAGACACATTTTTAGTGAAAAATGCGAGAGCTATGGAATCTTTGTCTCTGCGTCCTCAAACGATTAGGCAGGAAACTATTGCTTCTTTCGCACATTTAGCGAATTTACCTTGCAACGTAACTTATGAAGATGCTACACCAACAGTTTTAATTGGTGCAGAGCATTGGCATTTGTCAATCAGCAGCGAGGTACGGTGTGGTGGTAAGAATGAACCCGTTGCCTGTTTAACTGCCTTAGGCTGGGTGCTTTATGGAATCGCGTCCAGTAAAACTAAATCAGTGGAGTTTGTTAATCACGGTGTGTGTATCGAACCTTCCGATGAGGAGAAATTAGACTCTTTTATTAGGGAACAATACAAAATTGATTCGTTAGGTATTTCTAAAAAAGAAACTCTACATTCTAAGTCAGATAAACGTGCAGTCGAGATTTTAGAAAAAACTGCTAGACGTCTCCCCACTTCTGGTCGATTTGAGGTGGGTTTGCCGTGGCGTGACGATATACAACGCATTCCCGACAGCTACCCTCAAGCCATGTCACGATTTTTAAGTCTAGAAAGACGCATGGCTAAAGATGCTGACTTTGCAAAAGCATATAACGTGTTCATTTCAAACATGATCGCTAAAGGCTATGCAGAAGAATGTGCTCCCGAGTCATACTACGCCAACCACATTAAAGAAAAACAATCTTCTTTTATGAGGCTCTATTTACCCCATTTTGGCGTGTATCACCCTCAGAAACGTAAGCTTCGTGTAGTTCACGACGCCGCAGCCACGAATGCGGGCGTCAGCCTAAACTCTTTGTTGCTACCTGGTCCAGACCTGCTTCAGTCCTTGTTAGGTATTTTACTTCGGTTTCGCGAGGGCCGTATTGCTCTCACTGCTGATATCCGGGAAATGTTCCCTCAGGTAAGGATCAGAGAGCAAGATAGGGACGCCCTCCGGTTTCTCTGGAGGTCAAGCAGAGACCAACCTATAAAGGAGTTTAGGATGACAGCCATCATTTTCGGTGCGTGCTGCAGTCCATTTATAGCGCAATTTATTAAAAATAAAAACGCTCGTGAGCACGAAAGTTTATTTCCTAAAGCAGCTCATGCTATTTTGTACAATCATTATATGGACGATTATATTGACTCTCTCGATGACATTCAAGAGGCAGCACAACTGGCGGCAGATATTGTTGCCGTTCACAATGATGCCTACTTCGAGATGCGGGGCTGGATTTCCAACGATCCATCAGCGCTAAAATTTATTCCTGCTGATCTTAGGGCCACTCAACCGTCGTTGGAAATCAACCTTGGCAGCTGCTCTGCAAACAATATTAGAGCGTTGGGAGTATTGTGGAATCCCATAACAGATAATTTAGGGTTCCGCTCAGGCTTAGGTGAAACATTTCCAAACCCTCTCACAAAACGCAAAGTTCTTTGTCACCTCATGCGTGTGTACGACCCGTTAGGCTTATTAGCTCCAATAGTTGTTAAGGGTCGAATTTTATTTCAACACACGTGGAGGTCTAATGTCGACTGGGACACCGAGTTCCAACCCACGGAAGCATTAAGATGGTCTGATTGGTTTCAGGAGTTGTCAAAAGTAACTTCTTTGGAAATTCCGCGTTGGTATTCTAACTCTAAAAACTCTGAACCAACTCAGAGGGAGTTACACGTTTTTGCTGATGCAAGTGAGCTCGCGTACGCATGTGTCGCTTATTGGCGCCTTTTATACTCAGACGGCAGCATCGAGCTTTCTCTCATCTCTAGTAAGGCAAGAGTTACACCCTTGAAACCTATCTCTATCCCACGTTTAGAGCTCCAGGCCGCTTTAATAGCTTCTCGTCTCGCGGTCACCATTAAGGACAGTCATAGAAAACAACCGGCACATACTTTCTTTTGGACCGATTCTATGACAGTCCTTCAGTGGTTACGTAATGACGCGCGCTCTTTTAAGCCTTTTGTTGCCCATCGTTTAGGCGAAATTATTGAAAACTCTTGCGTCAGAGACTGGCGATGGGTACCAACGGAATTGAATGTTGCCGATGACGCTACCAGAACGAGATCAATTAACCTCGACATGTCCCACAGATGGTTTCGCGGTCCATCTTTTCTTTTTAAATCCGTTGAGGACTGGCCTACAGAGCCAAGGTTTGCCTCACCAAACACCGATGAACTTAAGACCAATAGTTATGAGTTGGTCGGACTAACTTCCTTTGTCGAAGAGTTACCGACTCCGGTCACAGCCATTTTTGCTAATTTTAGTAATTGGCAGCGCTTATTACGTGCCACAGCCCGGGTACTTCAAGCTGCGGCAAAGTTTGGTGTAATTTTGGCTTCCATTAGAAATTCTAAATTGAAAGGCGAAATAGTTTGTGCCCGCCATCCTTCAACGTCCACTACTCTACCACCTCTTAGTGCGGATTTAATAAAGGCCGCTGAAAGCCAAATTATGCAACGAACACAGGTCGAGAGCTTTTCCATAGAATTTCTTCATATCCTGAACTCGAAGCCTATTCCTCCGAACAGTCGTCTCAGAAAACTGTCACCCGCTTTGGGAGAGGACAAGTTGCTGCGGTTAGCCGGAAGAATTAAAGCCGCAGAAGGCATTGACCCTGACACACGCTTCCCCATCCTTCTTGACGGTCGTCACCCAATTGTACGTTTATTGGTACAATTTTATCATCGAAAAGCGGGTCACGCAAATTATGAACTAGTCGTGAACGAATTAAGACAAAAATTCTGGTTGTTAAGGCTGAGGAACACAGTGAGAACAGTAGCAAAAGAGTGTCCACTCTGCAGAATTAGAAAATCCTTGCCGGTGAACCCGAAAACAGGAGATCTGCCACCTGAAAGATTAGCTCACCATCGACGGCCCTTTACTTTTACGGGTCTGGACTACTTCGGCCCCGTAAGCGTGACTATCGGGCGCAGGCATGAAAAACGTTATGTGGCCCTTTTCACCTGTTTAACTGTCAGAGCCCTTCACCTAGAAATGGTACATAGTCTATCGACTGACTCTGCTATCATGGCTATTAGAAGATTCATTGCAAGACGGGGCTGTCCAAACATTATTTTCTCGGACAACGGAACCTGCTTTGTTGGTGCCAATCGCATTCTCAGAGGTTTCTACGGAGAAAATGTCGAAGATTTCACAAGCACTCAAGGAATACTCTGGAAGTTCATCCCACCTGCGGCACCTAATTTCGGAGGATGTTGGGAGCGCTTGGTGCGATCAGTAAAGGTAGCTCTGAACGCAACATTAACCGAACGAGCTCCAAAAGAAGAAACCTTGAGCGTCTTACTAGCCGAGGCAGAAGCCATTGTCAATTCACGTCCATTAACTCATGTATCTACAGATCCTGACGACCCGACAACACTCACACCATTTCATTTCTTAATCGGTTCTTCGTCCGTGCAGACCTTACCTACTGCCTTGAACGATCACGATTTGGTCAGCCGTTCCGAATGGAGGAAAGCATTGAGGCTAGCGGATCATTTTTGGTCGCGTTGGATGCGCGAGGTTCTCCCGACCCTACAACCACGTGAGCAGTCAAGAGGCAACCGCAGTTCAACAGCTTTTCAAGAGGGTGACGTAGTAATTATTGCTGACTTTAACTTGCCCCGCGGAATATGGCCACGAGGACGTGTTGCGAAAGTGTACCCTGGGAAAGATGGCGTGATAAGGGTAGTGGACGTTGCAACAGCAGGGGGAATGCTACGCCGACCCGTACGAAAGCTGAAACGTAAGCTTCGTGTAGTTCACGACGCCGCAGCCACGAATGCGGGCGTCAGCCTAAACTCTTTGTTGCTACCTGGTCCAGACCTGCTTCAGTCCTTGTTAGGTATTTTACTTCGGTTTCGCGAGGGCCGTATTGCTCTCACTGCTGATATCCGGGAAATGTTCCCTCAAGTAAGGATCAGAGAGCAAGATAGGGACGCCCTCCGGTTTCTCTGGAGGTCAAGCAGAGACCAACCTATAAAGGAGTTTAGGATGACAGCCATCATTTTCGGTGCGTGCTGCAGTCCATTTATAGCGCAATTTATTAAAAATAAAAACGCTCGTGAGCACGAAAGTTTATTTCCTAAAGCAGCTCATGCTATTTTGTACAATCATTATATGGACGATTATATTGACTCTCTCGATGACATTCAAGAGGCAGCACAACTAGCGGCGGATATTGTTGCCGTTCACAATGATGCCTACTTCGAGATGCGGGGCTGGATTTCCAACGATCCATCAGCGCTAAAATTTATTCCTGCTGATCTTAGGGCCACTCAACCGTCGTTGGAAATCAACCTTGGCAGCTGCTCTGTAAACAATATTAGAGCGTTGGGAGTATTGTGGAATCCCATAACAGATAATTTAGGGTTCCGCTCAGGCTTAGGTGAAACATTTCCAAACCCTCTCACAAAACGCAAAGTTCTTTGTCACCTCATGCGTGTGTACGACCCGTTAGGCTTATTAGCTCCAATAGTTGTTAAGGGTAGAATTTTATTTCAACAAACGTGGAGGTCTAATGTCGACTGGGACACCGAGTTCCAACCCACGGAAGCATTAAGATGGTCTGATTGGTTTCAGGAGTTGTCAAAAGTAACTTCTTTGGAAATTCCGCGTTGGTATTCTAACTCTAAAAACTCTGAACCAACTCAGAGGGAGTTCCACATTTTTGCTGATGCAAGTGAGCTCGCGTACGCATGTGTCGCTTATTGGCGCCTTTTGTACTCAGACGGCAGCATCGAGCTTTCTCTCATCTCTAGTAAGGCAAGAGTTACACCCTTGAAACCTATCTCTATCCCACGTTTAGAGCTCCAAGCCGCTTTAATAGCTTCTCGTCTCGCGGTCACCATTAAGGACAGTCATAGAAAACAACCGGCACATACTTTCTTTTGGACCGATTCTATGACAGTCCTTCAGTGGTTACGTAATGACGCGCGCTCTTTTAAGCCTTTTGTTGCCCATCGTTTAGGCGAAATTATTGAAAACTCTTGCGTCAGAGACTGGCGATGGATACCAACGGACTTGAATGTTGCCGACGACGCTACCAGAACGCGATCAATTAACCTCGACACGACCCACAGATGGTTTCGCGGTCCATCTTTTCTTTTTAAATCCGTTGAGGACTGGCCTACAGAGCCAAGGTTTGCCTCACCAAACACCGATGAACTTAAGACCAATAGTTATGAGTTGGTCGGACTAACTTCCTTTGTCGAAGAGTTACCGACTCCGGTCACAGCCATTTTTGCTAATTTTAGTAATTGGCAGCGCTTATTACGTGCCACAGCCCGGGTACTTCAAGCTGCGGCAAAGTTTGGTGTAATTTTGGCTTCCATTAGAAATTCTAAATTGAAAGGCGAAATTGTTTGTGCCCGCCATCCTTCAACGTCCACTACTCTGCCACCTCTTAGTGCAGATTTAATAAAGGCCGCCGAAAGGCAAATTATGCAACGAACACAGGTCGAGAGCTTTTCCATAGAATTTCTTCATATCCTGAACTCGAAGCCTATTCCTCCGAACAGTCGTCTCAGAAAACTGTCACCCGCTTTGGGAGAGGACAAGTTGCTGCGGTTAGCCGGAAGAATTAAAGCCGCAGAAGGCATTGACCCTGACACACGCTTCCCCATCCTTCTTGACGGTCGTCACCCAATTGTACGTTTATTGGTACAATTTTATCATCGAAAAGCGGGTCACGCAAATTATGAACTAGTCGTGAACGAATTAAGACAAAAATTCTGGTTGTTAAGACTGAGGAACACAGTGAGAACAGTAGCAAAAGAGTGTCCACTCTGCAGAATTAGAAAGTCCTTGCCGGTGAACCCGAAAACAGGAGATCTGCCACCTGAAAGATTAGCTCACCATCGACGGCCCTTTACTTTTACGGGTCTGGACTACTTCGGCCCCGTAAGCGTCACTATCGGGCGCAGGCATGAAAAACGTTATGTAGCCCTTTTCACCTGTTTAACTGTCAGAGCCCTTCACCTAGAAATGGTACATAGTCTATCGACTGACTCTGCTATCATGGCTATTAGAAGATTCATTGCAAGACGGGGCTGTCCAAACATTATTTTCTCGGACAACGGAACCTGCTTTGTTGGTGCCAATCGCATTCTCAGAGGTTTCTATGGAGAAAATGTCGAAGATTTCACAAGCACTCAAGGAATACTCTGGAAGTTCATCCCACCGGCGGCACCTAATTTCGGAGGATGTTGGGAGCGCTTGGTGCGATCAGTAAAGGTAGCTCTGAACGCAACATTAACCGAACGAGCTCCAAAAGAAGAAACCTTGAGCGTTTTACTAGCCGAGGCAGAAGCCATTGTCAATTCACGTCCATTAACTCATGTATCTACAGATCCTGACGACCCGACAACACTCACACCATTTCATTTCTTAATCGGTTCTTCGTCCGTGCAGACCTTACCTACTGCCTTGAACGATCACGATTTGGTCAGCCGTTCCGAATGGAGGAAAGCATTGAGGCTAGCGGATCATTTTTGGTCGCGTTGGATGCGCGAGGTTCTCCCGACCCTACAACCACGTGAGCAGTCAAGAGGCAACCGCAGTTCAACAGCTCTTCAAGAGGGTGACGTAGTAATTATTGCTGACTTCAACTTGCCCCGCGGAATATGGCCACGAGGACGTGTTGCGAAAGTGTACCCTGGGAAAGATGGCGTGATAAGGGTAGTGGACGTTGCAACAGCAGGGGGAATGCTACGCCGACCCGTACGAAAGCTGGCTCAAAAGGCCGCCGTAGAGGCCCTCGCCCTGCGCCGACGTCTTGAGCACGAGCAGGAGTTGGCTGAACGTGAGAGGCAACGTGAAAGTCGACTGGCAGCACTCCGTCAGCAGGTAGAGGAGGGCGAACTGAAGGCCGAACTTGCCGCTCTCGACGCGGAAGCCGCGGCAAGTCACAGCAGTCGCAGTGGTTCTGCCAGGGTAAGCGTAGAAAGAACAGAAAGATGGGTACAAAGTTTAGAACAGCCAGTTTGCGTTGGCGAAAATACAGTTAATAGAGGCATTCCCGCAGTAGGGCGAGAGCAAGTAGTGGTTCCGCCTCCCGGCCACCAGGCACCTCTGCCGGCCACTGGGTCAACTGCATCCCCTGTTAACCGTTTTGTTCATCAGAAACAACTTTTAAACGTCACTAAAGCGTCCGAGGCGGCCGTACTTACGCGACCGCTCATTTCCACGGAGGTTGATCAGAGTAGTCTGCTTCAGGCTGTTGCTGACACTGCAGCTGCGGCCAAGGCGCTTGCTACTTCGCACCGTCATAAACATAAGATCGAATTGTTTCCTTTCGACGGAGACGCCTTAACATGGCTACATTTCAAACGTATTTTTGATTTAACCAAAAACAATTTTTCAAATATTGAAAATATTAGTCGGTTACAAAATGCACTTCGCGGCGCGGCCCGAGATGCAGTCGCGTCACTGTTGCTGGCTACAGACAACCCGAACGACATTATAAGAGCTCTGGAGGAGAACTTCGCTCGCCCGGAAATTATAGTATTTAAGGAAGTCTCCGCTCTTAAAAATCTACCACGTTTGGGAAATGACTTGAAAGAGTTAATTACGATAACGAATAAGGTACGTAATTCTATATCTTCTTTTAAAATACTGAATAAAATTGAGTACTTGCATTCTCCAGAACTATTTCACGCCGTCTTAGGAAAATTAAACCCGGTTACTAAAGTAAGATGGACGGACTTTGCTATGCAAGATACTACAGGACGTCCTAAATTAGAAATTATGTCCGATTTTTTGAGGCGCGAGTTAGATCAACTTATTCGGTTCGGTTTATCACCGGAATCTTGCTCGATCCAACATTCACCAGAAAACACTCATCTAAACAAACCGTATAAACGGGAAAATATTCACATAGTTACACACTCTAAACTAAATTCTAATGCGGCGTCTACACAAAAGCTTGAATGCGCGTTTTGCAAAAAAGATCACAATATTAAGTCATGTTCTGAGTTCAAAGCCTTATCTGTTGATGAAAGGTGGGTCTGGCTGCGTGAGGTAAAAGCGTGTTATAGATGTCTTAGGCGTAGTTCACATCAGTGGAAAACATGTAAAGTTAACCCTTGTGGTGTTGATGGGTGTCTAATACGTCATCACCCGTTAATGCATGGTAAAGAACCTGTCTCTTCTGTCAATACTATGTTCGACACGCGATCCACCGAAAATGATCATACGACTAAGCACCACGAACCTGCATCTGTCGAAAAGGTAATAGTTTCTACCACTTCTACAGGTGTTCAAGAACCCAGCTCCATCTTAACTCTGTGCCCACGTGTATTTCTGAAAATCTTACCCGTTACTGTCTCTGGTCCCTCAGGAAGTTGCAATGTTTACGCACTTCTCGATGATGGTAGCACTGCTACGCTCATTGACTCAAGTATTGCTACTCAAATCGGTGCGACAGGGCCTCACCAGAAAATAACGGTTAATGGTATAGGCGGTCTCAGTAGAAACGCTACGATATCGTATGTAGATTTTCACATTAAGGGTAGGCACACACGAGACACATTTTTAGTGAAAAATGCGAGAGCTATGGAGTCTTTGTCTCTGCGTCCTCAAACGATTAGGCAGGAAACTATTGCTTCTTTCGCACATTTAGCGAATTTACCTTGCAACGTAACTTATGAAGATGCTACACCAACAGTTTTAATTGGTGCAGAGCATTGGCATTTGTCAATCAGCAGCGAGGTACGGTGTGGTGGTAAGAATGAACCCGTTGCCTGTTTAACTGCCTTAGGCTGGGTGCTTTATGGAATCGCGTCCAGTAAAACTAAATCAGTGGAGTTTGTTAATCACGGTGTGAACTATTACCTTTTCGACAGATGCAGTACTTCCCAACATGTAGACAGCATTGCTCCGAGTGAGACGTCTAAGTCAAAATCATCACGCTCGTCATCCACAATTAAGGCTCAAAAGGCCGCCGTAGAGGCCCTCGCCCTGCGCCGACGTCTTGAGCACGAGCAGGAGCTGGCTGAACGTGAGAGGCAACGTGAAAGTCGACTGGCAGCACTCCGTCAGCAGGTAGAGGAGGGCGAACTGAAGGCCGAACTTGCCGCTCTCGACGCGGAAGCCGCGGCATGTCACAGCAGTCGCAGTGGTTCTGCCAGGGTAAGCGTAGAAAGAACAGAAAGATGGGTACAAAGTTTAGGACAGCCAGTTTGCGTTGGCGAAAATACAGTTAATAGAGGCATCCCCGCAGTAGGGCGAGAGCAAGTAGTGGTTCCGCCTCCCGGCCACCAGGCACCTCTGCCGGCCACTGGGTCAACTGCATCCCCTGTTAACCGTTTTGTTCATCAGAAACAACTTTTAAACGTCACTAAAGCGTCCGAGGCGGCCGTACTTACGCGACCGCTCATTTCCACGGAGGTTGATCAGAGTAGTCTGCTTCAGGCTGTTGCTGACACTGCAGCTGCGGCCAAGGCGCTTGCTACTTCGCACCGTCATAAACATAAGATCGAATTGTTTCCTTTCGACGGAGACGCCTTAACATGGCTACATTTTAAACGTATTTTTGATTTAACTAAAAACAATTTTTCAAATATTGAAAATATTAGTCGGTTACAAAATGCACTTCGCGGCGCGGCCCGAGATGCAGTCGCGTCACTGTTGCTGGCTACAGACAACCCGAACGATATTATAAGAGCTCTGGAGGAGAACTTCGCTCGCCCGGAAATTATAGTATTTAAGGAAGTCTCCGCTCTTAAAAATCTACCACGTTTGGGAAATGACTTGAAAGAGTTAATTACGATAACGAATAAGGTACGTAATTCTATATCTTCTTTTAAAATACTGAATCAAATTGAGTACTTGCATTCTCCAGAACTATTTCACGACGTCTTAGGAAAATTAAACCCGGTTACTAAAGTAAGATGGACGGACTTTGCTATGCAAGATACTACAGGGCGTCCTAAATTAGAGATTATGTCCGATTTTTTGAGGCGAGAGTTAGATCAACTTATTCGGTTCGGTTTATCACCGGAATCTTGCTCGATCCAACATTCATCACAAAACACTCATCTAAACAAACCGTATAAACGGGAAAATATTCACATAGTTACACACTCTAAACTAAATTCTAAGGCGGCGTCTACACAAAAGCTTGAATGCGCGTTTTGCAAAAAAGATCACAATATTAAGTCATGTTCTGAGTTCAAAGCCTTATCTGTTGATGAAAGGTGGGTCTGGCTGCGTGAGGTAAAAGCGTGTTATAGATGTCTTAGGCGTAGTTCACATCAGTGGAAAACATGTAAAGTTAACCCTTGTGGTGTTGATGGGTGTCTAATACGTCATCACCCGTTAATGCATGGTAAAGAACCTGTCTCTTCTGTCAATACTATGTTCGACACGCGATCCACCGAAAATGATCATACGACTAAGCACCACGAACCTGCATCTGTCGAAAAGGTAATAGTTTCTACCACTTCTACAGGTGTTCAAGAACCCAGCTCCATCTTAACTCTGTGCCCACGTGTATTTCTGAAAATCTTACCCGTTACTGTCTCTGGTCCCTCAGGAAGTTGCAATGTTTACGCACTTCTCGATGACGGTAGCACTGCTACGCTCATTGACTCAAGAATTGCTACTCAAATCGGTGCGACAGGGCCTCACCAGAAAATAACGGTTAATGGTATAGGCGGTCTCAGTAGAAACGCTACGATATCGTATGTAGATTTTCACATTAAGGGTAGGCACACACGAGACACATTTTTAGTGAAAAATGCGAGAGCTATGGAGTCTTTGTCTCTGCGTCCTCAAACGATTAGGCAGGAAACTATTGCTTCTTTCGCACATTTAGCGAATTTACCTTGCAACGTAACTTATGAAGATGCTACACCAACAGTTTTAATTGGTGCAGAGCATTGGCATTTGTCAATCAGCAGCGAGGTACGGTGTGGTGGTAAGAATGAACCCGTTGCCTGTTTAACTGCCTTAGGCTGGGTGCTTTATGGAATCGCGTCCAGTAAAACTAAATCAGTGGAGTTTGTTAATCACGGTGTGTGTATCGAACCTTCCGATGAGGAGAAATTAGACTCTTTTATTAGGGAACAATACAAAATTGATTCGTTAGGTATTTCTAAAAAAGAAACTCTACATTCTAAGTCAGATAAACGTGCAGTCGAGATTTTAGAAAAAACTGCTAGACGTCTCCCCACTTCTGGTCGATTTGAGGTGGGTTTGCCGTGGCGTGACGATATACAACGCATTCCCGACAGCTACCCTCAAGCCATGTCACGATTTTTAAGTCTAGAAAGGCGCATGGCCAAAGATGCTGACTTTGCAAAAGCATATGACGTGTTCATTTCAAACATGATCGCTAAAGGCTATGCAGAAGAATGTGCTCCCGAGTCATACTACGCCAACCACATTAAAGATAAACAATCTTCTTTTATGAGGCTCTATTTACCCCATTTTGGCGTGTATCACCCTCAGAAACGTAAGCTTCGTGTAGTTCACGACGCCGCAGCCACGAATGCGGGCGTCAGCCTAAACTCTTTGTTGCTACCTGGTCCAGACCTGCTTCAGTCCTTGTTAGGTATTTTACTTCGGTTTCGCGAGGGCCGTATTGCTCTCACTGCTGATATCCGGGAAATGTTCCCTCAAGTAAGGATCAGAGAGCAAGATAGGGACGCCCTCCGGTTTCTCTGGAGGTCAAGCAGAGACCAACCTATAAAGGAGTTTAGGATGACAGCCATCATTTTCGGTGCGTGCTGCAGTCCATTTATAGCGCAATTTATTAAAAATAAAAACGCTCGTGAGCACGAAAGTTTATTTCCTAAAGCAGCTCATGCTATTTTGTACAATCATTATATGGACGATTATATTGACTCTCTCGATGACATTCAAGAGGCAGCACAACTGGCGGCAGATATTGTTGCCGTTCACAATGATGCCTACTTCGAGATGCGGGGCTGGATTTCCAACGATCCATCAGCGCTAAAATTTATTCCTGCTGATCTTAGGGCCACTCAACCGTCGTTGGAAATCAACCTTGGCAGCTGCTCTGCAAACAATATTAGAGCGTTGGGAGTATTGTGGAATCCCATAACAGATAATTTAGGGTTCCGCTCAGGCTTAGGTGAAACATTTCCAAACCCTCTCACAAAACGCAAACTTCTTTGTCACCTGATGCGTGTGTACGACCCGTTAGGCTTATTAGCTCCAGTAGTTGTTAAGGGTCGAATTTTATTTCAACAAACGTGGAGGTCTAATGTCGACTGGGACACCGAGTTCCAACCCACGGAAGCATTAAGATGGTCTGATTGGTTTCAGGAGTTGTCAAAAGTAACTTCTTTGGAAATTCCGCGTTGGTATTCTAACTCTAAAAACTCTGAACCAACTCAGAGGGAGTTACACGTTTTTGCTGATGCAAGTGAGCTCGCGTACGCATGTGTCGCTTATTGGCGCCTTTTATACTCAGACGGCAGCATCGAGCTTTCTCTCATCTCTAGTAAGGCAAGAGTTACACCCTTGAAACCTATCTCTATCCCACGTTTAGAGCTCCAGGCCGCTTTAATAGCTTCTCGTCTCGCGGTCACCATTAAGGACAGTCATAGAAAACAACCGGCACATACTTTCTTTTGGACCGATTCTATGACAGTCCTTCAGTGGTTACGTAATGAGTGTCCACTCTGCAGAATTAGAAAATCCTTGCCGGTGAACCCGAAAACAGGAGATCTGCCACCTGAAAGATTAGCTCACCATCGACGGCCCTTTACTTTTACGGGTCTGGACTACTTCGGCCCCGTAAGCGTCACTATCGGGCGCAGGCATGAAAAACGTTATGTGGCCCTTTTCACCTGTTTAACTGTCAGAGCCCTTCACCTAGAAATGGTACATAGTCTATCGACTGACTCTGCTATCATGGCTATTAGAAGATTCATTGCAAGACGGGGCTGTCCAAACATTATTTTCTCGGACAACGGAACCTGCTTTGTTGGTGCCAATCGCATTCTCAGAGGTTTCTACGGAGAAAATGTCGAAGATTTCACAAGCACTCAAGGAATACTCTGGAAGTTCATCCCACCTGCGGCACCTAATTTCGGAGGATGTTGGGAGCGCTTGGTGCGATCAGTAAAGGTAGCTCTGAACGCAACATTAACCGAACGAGCTCCAAAAGAAGAAACCTTGAGCGTCTTACTAGCCGAGGCAGAAGCCATTGTCAATTCACGTCCATTAACTCATGTATCTACAGATCCTGACGACCCGACAACACTCACACCATTTCATTTCTTAATCGGTTCTTCGTCCGTGCAGACCTTACCTACTGCCTTGAACGATCACGATTTGGTCAGCCGTTCCGAATGGAGGAAAGCATTGAGGCTAGCGGATCATTTTTGGTCGCGTTGGATGCGCGAGGTTCTCCCGACCCTACAACCACGTGAGCAGTCAAGAGGCAACCGCAGTTCAACAGCTTTTCAAGAGGGTGACGTAGTAATTATTGCTGACTTTAACTTGCCCCGCGGAATATGGCCACGAGGACGTGTTGCGAAAGTGTACCCTGGGAAAGATGGCGTGATAAGGGTAGTGGACGTTGCAACAGCAGGGGGAATGCTACGCCGACCCGTACGAAAGCTGCTTCGTGTAGTTCACGACGCCGCAGCCACGAATGCGGGCGTCAGCCTAAACTCTTTGTTGCTACCTGGTCCAGACCTGCTTCAGTCCTTGTTAGGTATTTTACTTCGGTTTCGCGAGGGCCGTATTGCTCTCACTGCTGATATCCGGGAAATGTTCCCTCAAGTAAGGATCAGAGAGCAAGATAGGGACGCCCTCCGGTTTCTCTGGAGGTCAAGCAGAGACCAACCTATAAAGGAGTTTAGGATGACAGCCATCATTTTCGGTGCGTGCTGCAGTCCATTTATAGCGCAATTTATTAAAAATAAAAACGCTCGTGAGCACGCAAGTTTATTTCCTAAAGCAGCTCATGCTATTTTGTACAATCATTATATGGACGATTATATTGACTCTCTCGATGACATTCAAGAGGCAGCACAACTGGCGGCAGATATTGTTGCCGTTCACAATGATGCCTACTTCGAGATGCGGGGCTGGATTTCCAACGATCCATCAGCACTAAAATTTATTCCTGCTGATCTTAGGGCCACTCAACCGTCGTTGGAAATCAACCTAGGCAGCTGCTCTGCAAACAATATTAGAGCGTTGGGAGTATTGTGGAATCCCATAACAGATAATTTAGGGTTCCGCTCAGGCTTAGGTGAAATATTTCCAAACCCTCTCACAAAACGCAAAGTTCTTTGTCACCTCATGCGTGTGTACGACCCGTTAGGCTTATTAGCTCCAATAGTTGTTAAGGGTCGAATTTTATTTCAACAAACGTGGAGGTCTAATGTCGACTGGGACACCGAGTTCCAACCCACGGAAGCATTAAGATGGTCTGATTGGTTTCAGGAGTTGTCAAAAGTAACTTCTTTGGAAATTCCGCGTTGGTATTCTAACTCTAAAAACTCTGAACCAACTCAGAGGGAGTTACACGTTTTTGCTGATGCAAGTGAGCTCGCCTACGCATGTGTCGCTTATTGGCGCCTTTTATACTCAGACGGCAGCATCGAGCTTTCTCTCATCTCTAGTAAGGCAAGAGTTACACCCTTGAAACCTATCTCTATCCCACGTTTAGAGCTCCAGGCCGCTTTAATAGCTTCTCGTCTCGCGGTCACCATTAAGGACAGTCATAGAAAACAACCGGCACATACTTTCTTTTGGACCGATTCTATGACAGTCCTTCAGTGGTTACGTAATGACGCGCGCTCTTTTAAGCCTTTTGTTGCCCATCGTTTAGGCGAAATTATTGAAAACTCTTGCGTCAGAGACTGGCGATGGGTACCAACGGAATTGAATGTTGCCGACGACGCTACCAGAACGCGATCAATTAACCTCGACATGTCCCACAGATGGTTTCGCGGTCCATCTTTTCTTTTTAAATCCATTGAGGACTGGCCTACAGAGCCAAGGTTTGCCTCACCAAACACCGATGAACTTAAGACCAATAGTTATGAGTTGGTCGGACTAACTTCCTTTGTCGAAGAGTTACCGACTCCGGTCACAGCCATTTTTGCTAATTTTAGTAATTGGCAGCGCTTATTACGTGCCACAGCCCGGGTACTTCAAGCTGCGGCAAAGTTTGGTGTAATTTTGGCTTCCATTAGAAATTCTAAATTGAAAGGCGAAATAGTTTGTGCCCGCCATCCTTCAGCGTCCACTACTCTACCACCTCTTAGTGCGGATTTAATAAAGGCCGCTGAAAGGCAAATTATGCAACGAACACAGGTCGAGAGCTTTTCCATAGAATTTCTTCATATCCTGAACTCGAAGCCTATTCCTCCGAACAGTCGTCTCAGAAAACTGTCACCCGCTTTGGGAGAGGACAAGTTGCTGCGGTTAGCCGGAAGAATTAAAGCCGCAGAAGGCATTGACCCTGACACACGCTTTCCCATCCTTCTTGACGGTCGTCACCCAATTGTACGTTTATTGGTACAATTTTATCATCGAAAAGCGGGTCACGCAAATTATGAACTAGTCGTGAACGAATTAAGACAAAAATTCTGGTTGTTAAGGCTGAGGAACACAGTGAGAACAGTAGCAAAAGAGTGTCCACTCTGCAGAATTAGAAAATCCTTGCCGGTGAACCCGAAAACAGGAGATCTGCCACCTGAAAGATTAGCTCACCATCGACGGCCCTTTACTTTTACGGGTCTGGACTACTTCGGCCCCGTAAGCGTGACTATCGGGCGCAGGCATGAAAAACGTTATGTGGCCCTTTTCACCTGTTTAACTGTCAGAGCCCTTCACCTAGAAACGGTACATAGTCTATCGACTGACTCTGCTATCATGGCTATTAGAAGATTCATTGCAAGACGGGGCTGTCCAAACATTATTTTCTCGGACAACGGAACCTGCTTTGTTGGTGCCAATCGCATTCTCAGAGGTTGCTACGGAGAAAATGTCGAAGATTTCACAAGCACTCAAGGAATACTCTGGAAGTTCATCCCACCTGCGGCACCTAATTTCGGAGGATGTTGGGAGCGCTTGGTGCGATCAGTAAAGGTAGCTCTGAACGCAAAATTAACGCGACTGCATCTCGGGCCGCGCCGCGAAGTGCATTTTGTAACCGACTAA
Protein
MPTNPATSSGVQVNIIQPSTSQHVDSIAPSETSKSKSSRSSSTIKAQKAAVEALALRRRLEHEQELAERERQRESRLAALRQQVEEGELKAELAALDAEAAASHSSRSGSARVSVERTERWVQSLGQPVCVGENTVNRGIPAVGREQVLVPPPGHQAPLPATGSTASPVNRFVHQKQVLNVTKASEAAVLTRPLISTEVDQSSLLQAVADTAAAAKALATSHRHKHKIELFPFDGDALTWLHFKRIFDLTKNNFSNIENISRLQNALRGAARDAVASLLLATDNPNDIIRALEENFARPEIIVFKEVSALKNLPRLGNDLKELITITNKVRNSISSFKILNQIEYLHSPELFHAVLGKLNPVTKVRWTDFAMQDTTGRPKLEIMSDFLRRELDQLIRFGLSPESCSIQHSPQNTHLNKPYKRENIHIVTHSKQNSKAASTQKLECAFCKKDHNIKSCSEFKALSVDERWVWLREVKACYRCLRRSSHQWKTCKVNPCGVDGCLIRHHPLMHGKEPASSVNTMFDTQSTENDHTTKHHEPASVEKVIVSTTSTGVQEPSSILTLCPRVFLKILPVTVSGPSGSCNVYALLDDGSTATLIDSSIATQIGATGPHQKITVNGIGGLSRNATISYVDFHIKGRHTRDTFLVKNARAMESLSLRPQTIRQETIASFAHLANLPCNVTYEDATPTVLIGAEHWHLSISSEVRCGGKNEPVACLTALGWVLYGIASSKTKSVEFVNHGVCIEPSDEEKLDSFIREQYKIDSLGISKKETLHSKSDKRAVEILEKTARRLPTSGRFEVGLPWRDDIQRIPDSYPQAMSRFLSLERRMAKDADFAKAYNVFISNMIAKGYAEECAPESYYANHIKEKQSSFMRLYLPHFGVYHPQKRKLRVVHDAAATNAGVSLNSLLLPGPDLLQSLLGILLRFREGRIALTADIREMFPQVRIREQDRDALRFLWRSSRDQPIKEFRMTAIIFGACCSPFIAQFIKNKNAREHESLFPKAAHAILYNHYMDDYIDSLDDIQEAAQLAADIVAVHNDAYFEMRGWISNDPSALKFIPADLRATQPSLEINLGSCSANNIRALGVLWNPITDNLGFRSGLGETFPNPLTKRKVLCHLMRVYDPLGLLAPIVVKGRILFQHTWRSNVDWDTEFQPTEALRWSDWFQELSKVTSLEIPRWYSNSKNSEPTQRELHVFADASELAYACVAYWRLLYSDGSIELSLISSKARVTPLKPISIPRLELQAALIASRLAVTIKDSHRKQPAHTFFWTDSMTVLQWLRNDARSFKPFVAHRLGEIIENSCVRDWRWVPTELNVADDATRTRSINLDMSHRWFRGPSFLFKSVEDWPTEPRFASPNTDELKTNSYELVGLTSFVEELPTPVTAIFANFSNWQRLLRATARVLQAAAKFGVILASIRNSKLKGEIVCARHPSTSTTLPPLSADLIKAAESQIMQRTQVESFSIEFLHILNSKPIPPNSRLRKLSPALGEDKLLRLAGRIKAAEGIDPDTRFPILLDGRHPIVRLLVQFYHRKAGHANYELVVNELRQKFWLLRLRNTVRTVAKECPLCRIRKSLPVNPKTGDLPPERLAHHRRPFTFTGLDYFGPVSVTIGRRHEKRYVALFTCLTVRALHLEMVHSLSTDSAIMAIRRFIARRGCPNIIFSDNGTCFVGANRILRGFYGENVEDFTSTQGILWKFIPPAAPNFGGCWERLVRSVKVALNATLTERAPKEETLSVLLAEAEAIVNSRPLTHVSTDPDDPTTLTPFHFLIGSSSVQTLPTALNDHDLVSRSEWRKALRLADHFWSRWMREVLPTLQPREQSRGNRSSTAFQEGDVVIIADFNLPRGIWPRGRVAKVYPGKDGVIRVVDVATAGGMLRRPVRKLKRKLRVVHDAAATNAGVSLNSLLLPGPDLLQSLLGILLRFREGRIALTADIREMFPQVRIREQDRDALRFLWRSSRDQPIKEFRMTAIIFGACCSPFIAQFIKNKNAREHESLFPKAAHAILYNHYMDDYIDSLDDIQEAAQLAADIVAVHNDAYFEMRGWISNDPSALKFIPADLRATQPSLEINLGSCSVNNIRALGVLWNPITDNLGFRSGLGETFPNPLTKRKVLCHLMRVYDPLGLLAPIVVKGRILFQQTWRSNVDWDTEFQPTEALRWSDWFQELSKVTSLEIPRWYSNSKNSEPTQREFHIFADASELAYACVAYWRLLYSDGSIELSLISSKARVTPLKPISIPRLELQAALIASRLAVTIKDSHRKQPAHTFFWTDSMTVLQWLRNDARSFKPFVAHRLGEIIENSCVRDWRWIPTDLNVADDATRTRSINLDTTHRWFRGPSFLFKSVEDWPTEPRFASPNTDELKTNSYELVGLTSFVEELPTPVTAIFANFSNWQRLLRATARVLQAAAKFGVILASIRNSKLKGEIVCARHPSTSTTLPPLSADLIKAAERQIMQRTQVESFSIEFLHILNSKPIPPNSRLRKLSPALGEDKLLRLAGRIKAAEGIDPDTRFPILLDGRHPIVRLLVQFYHRKAGHANYELVVNELRQKFWLLRLRNTVRTVAKECPLCRIRKSLPVNPKTGDLPPERLAHHRRPFTFTGLDYFGPVSVTIGRRHEKRYVALFTCLTVRALHLEMVHSLSTDSAIMAIRRFIARRGCPNIIFSDNGTCFVGANRILRGFYGENVEDFTSTQGILWKFIPPAAPNFGGCWERLVRSVKVALNATLTERAPKEETLSVLLAEAEAIVNSRPLTHVSTDPDDPTTLTPFHFLIGSSSVQTLPTALNDHDLVSRSEWRKALRLADHFWSRWMREVLPTLQPREQSRGNRSSTALQEGDVVIIADFNLPRGIWPRGRVAKVYPGKDGVIRVVDVATAGGMLRRPVRKLAQKAAVEALALRRRLEHEQELAERERQRESRLAALRQQVEEGELKAELAALDAEAAASHSSRSGSARVSVERTERWVQSLEQPVCVGENTVNRGIPAVGREQVVVPPPGHQAPLPATGSTASPVNRFVHQKQLLNVTKASEAAVLTRPLISTEVDQSSLLQAVADTAAAAKALATSHRHKHKIELFPFDGDALTWLHFKRIFDLTKNNFSNIENISRLQNALRGAARDAVASLLLATDNPNDIIRALEENFARPEIIVFKEVSALKNLPRLGNDLKELITITNKVRNSISSFKILNKIEYLHSPELFHAVLGKLNPVTKVRWTDFAMQDTTGRPKLEIMSDFLRRELDQLIRFGLSPESCSIQHSPENTHLNKPYKRENIHIVTHSKLNSNAASTQKLECAFCKKDHNIKSCSEFKALSVDERWVWLREVKACYRCLRRSSHQWKTCKVNPCGVDGCLIRHHPLMHGKEPVSSVNTMFDTRSTENDHTTKHHEPASVEKVIVSTTSTGVQEPSSILTLCPRVFLKILPVTVSGPSGSCNVYALLDDGSTATLIDSSIATQIGATGPHQKITVNGIGGLSRNATISYVDFHIKGRHTRDTFLVKNARAMESLSLRPQTIRQETIASFAHLANLPCNVTYEDATPTVLIGAEHWHLSISSEVRCGGKNEPVACLTALGWVLYGIASSKTKSVEFVNHGVNYYLFDRCSTSQHVDSIAPSETSKSKSSRSSSTIKAQKAAVEALALRRRLEHEQELAERERQRESRLAALRQQVEEGELKAELAALDAEAAACHSSRSGSARVSVERTERWVQSLGQPVCVGENTVNRGIPAVGREQVVVPPPGHQAPLPATGSTASPVNRFVHQKQLLNVTKASEAAVLTRPLISTEVDQSSLLQAVADTAAAAKALATSHRHKHKIELFPFDGDALTWLHFKRIFDLTKNNFSNIENISRLQNALRGAARDAVASLLLATDNPNDIIRALEENFARPEIIVFKEVSALKNLPRLGNDLKELITITNKVRNSISSFKILNQIEYLHSPELFHDVLGKLNPVTKVRWTDFAMQDTTGRPKLEIMSDFLRRELDQLIRFGLSPESCSIQHSSQNTHLNKPYKRENIHIVTHSKLNSKAASTQKLECAFCKKDHNIKSCSEFKALSVDERWVWLREVKACYRCLRRSSHQWKTCKVNPCGVDGCLIRHHPLMHGKEPVSSVNTMFDTRSTENDHTTKHHEPASVEKVIVSTTSTGVQEPSSILTLCPRVFLKILPVTVSGPSGSCNVYALLDDGSTATLIDSRIATQIGATGPHQKITVNGIGGLSRNATISYVDFHIKGRHTRDTFLVKNARAMESLSLRPQTIRQETIASFAHLANLPCNVTYEDATPTVLIGAEHWHLSISSEVRCGGKNEPVACLTALGWVLYGIASSKTKSVEFVNHGVCIEPSDEEKLDSFIREQYKIDSLGISKKETLHSKSDKRAVEILEKTARRLPTSGRFEVGLPWRDDIQRIPDSYPQAMSRFLSLERRMAKDADFAKAYDVFISNMIAKGYAEECAPESYYANHIKDKQSSFMRLYLPHFGVYHPQKRKLRVVHDAAATNAGVSLNSLLLPGPDLLQSLLGILLRFREGRIALTADIREMFPQVRIREQDRDALRFLWRSSRDQPIKEFRMTAIIFGACCSPFIAQFIKNKNAREHESLFPKAAHAILYNHYMDDYIDSLDDIQEAAQLAADIVAVHNDAYFEMRGWISNDPSALKFIPADLRATQPSLEINLGSCSANNIRALGVLWNPITDNLGFRSGLGETFPNPLTKRKLLCHLMRVYDPLGLLAPVVVKGRILFQQTWRSNVDWDTEFQPTEALRWSDWFQELSKVTSLEIPRWYSNSKNSEPTQRELHVFADASELAYACVAYWRLLYSDGSIELSLISSKARVTPLKPISIPRLELQAALIASRLAVTIKDSHRKQPAHTFFWTDSMTVLQWLRNECPLCRIRKSLPVNPKTGDLPPERLAHHRRPFTFTGLDYFGPVSVTIGRRHEKRYVALFTCLTVRALHLEMVHSLSTDSAIMAIRRFIARRGCPNIIFSDNGTCFVGANRILRGFYGENVEDFTSTQGILWKFIPPAAPNFGGCWERLVRSVKVALNATLTERAPKEETLSVLLAEAEAIVNSRPLTHVSTDPDDPTTLTPFHFLIGSSSVQTLPTALNDHDLVSRSEWRKALRLADHFWSRWMREVLPTLQPREQSRGNRSSTAFQEGDVVIIADFNLPRGIWPRGRVAKVYPGKDGVIRVVDVATAGGMLRRPVRKLLRVVHDAAATNAGVSLNSLLLPGPDLLQSLLGILLRFREGRIALTADIREMFPQVRIREQDRDALRFLWRSSRDQPIKEFRMTAIIFGACCSPFIAQFIKNKNAREHASLFPKAAHAILYNHYMDDYIDSLDDIQEAAQLAADIVAVHNDAYFEMRGWISNDPSALKFIPADLRATQPSLEINLGSCSANNIRALGVLWNPITDNLGFRSGLGEIFPNPLTKRKVLCHLMRVYDPLGLLAPIVVKGRILFQQTWRSNVDWDTEFQPTEALRWSDWFQELSKVTSLEIPRWYSNSKNSEPTQRELHVFADASELAYACVAYWRLLYSDGSIELSLISSKARVTPLKPISIPRLELQAALIASRLAVTIKDSHRKQPAHTFFWTDSMTVLQWLRNDARSFKPFVAHRLGEIIENSCVRDWRWVPTELNVADDATRTRSINLDMSHRWFRGPSFLFKSIEDWPTEPRFASPNTDELKTNSYELVGLTSFVEELPTPVTAIFANFSNWQRLLRATARVLQAAAKFGVILASIRNSKLKGEIVCARHPSASTTLPPLSADLIKAAERQIMQRTQVESFSIEFLHILNSKPIPPNSRLRKLSPALGEDKLLRLAGRIKAAEGIDPDTRFPILLDGRHPIVRLLVQFYHRKAGHANYELVVNELRQKFWLLRLRNTVRTVAKECPLCRIRKSLPVNPKTGDLPPERLAHHRRPFTFTGLDYFGPVSVTIGRRHEKRYVALFTCLTVRALHLETVHSLSTDSAIMAIRRFIARRGCPNIIFSDNGTCFVGANRILRGCYGENVEDFTSTQGILWKFIPPAAPNFGGCWERLVRSVKVALNAKLTRLHLGPRREVHFVTD

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
6019
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04769
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  6019
 
 

Population Genetic Test Statistics

Pi
396.755254
Theta
186.743834
Tajima's D
2.285921
CLR
0.481655
CSRT
0.92080395980201
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号