SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11599
Annotation
PREDICTED:_uncharacterized_protein_LOC106720343_[Papilio_machaon]
Location in the cell
Cytoplasmic   Reliability : 1.902
 

Sequence

CDS
ATGTTAGGTATACGAGGTAATGCTTTGTTGGATACGGGAGCTAAGAGTAGCGTTGCCGGAGCGTTGCTTTATGAATTGCTGTTAAAGCATAACCATCCGTGTGAGGAAACCAGGCGTCGGGTGAGGCTTGCAGACGGTTCCGCGCGCACCCGCCGAGTTTTGCTCACTACTCTAGAAGTAAGGATAAGTCCCGAAAGGTCAGTAACCCTTGAATTTACTGTTTTTCCAGATGCTCAAAATAATGAAACTTTGCTTGGCATGGATTTTTTGGTGGCGGCAGGTATTGTGCTTGACTTTGCTTCATCCACTTGGCATTTTTCGGGAAAACGGGTTACCTATCCAATTGAATATGAGTGCCCTAAGCCATGCATGTTTGCTTCTACTGCTGACTTCCTGCGTGATGATAAGGGTTCTATGCTTGGCTCCGATGAACGGCAGCAGCTATCACATTTATTGCAGGAGAATGGAGACATCTTTAGGGTGGGGGGAGCCCCAACCCTTTACGCCGAGCACCACATTGATACCGGTGATCATCCGCCTATATCGGTACCGCCGTATAGGCTCACTCCTGTGCTTCAACAGCGAGGAGAGGTTCTCGCAATCGATTTGTTCGGGCCACTGCCAGAAGGAGAGCAGGGGGAGCGATGGGTACTCCTGGTAGAGGATGTAGCTACAAGATGGGTAGAACTCTACGCACTTGTTGATGCCACCGCCGTGGCTTGCTCCCGAGTCCTACTGGAAGAGTATTTCCTTCGTTATGGCTTGCTTATGCGTCTAGGGGTGTAA
Protein
MLGIRGNALLDTGAKSSVAGALLYELLLKHNHPCEETRRRVRLADGSARTRRVLLTTLEVRISPERSVTLEFTVFPDAQNNETLLGMDFLVAAGIVLDFASSTWHFSGKRVTYPIEYECPKPCMFASTADFLRDDKGSMLGSDERQQLSHLLQENGDIFRVGGAPTLYAEHHIDTGDHPPISVPPYRLTPVLQQRGEVLAIDLFGPLPEGEQGERWVLLVEDVATRWVELYALVDATAVACSRVLLEEYFLRYGLLMRLGV

Summary

Pfam
PF00078   RVT_1        + More
PF17921   Integrase_H2C2
PF00665   rve
PF17917   RT_RNaseH
PF00077   RVP
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR036875   Znf_CCHC_sf       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR041373   RT_RNaseH       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR001584   Integrase_cat-core       
IPR001969   Aspartic_peptidase_AS       
IPR018061   Retropepsins       
SUPFAM
SSF50630   SSF50630        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
261
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.27477
Exp number, first 60 AAs:
0.0028
Total prob of N-in:
0.01299
outside
1  -  261
 
 

Population Genetic Test Statistics

Pi
251.12277
Theta
156.423603
Tajima's D
2.904035
CLR
0
CSRT
0.975601219939003
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号