SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11575
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.804
 

Sequence

CDS
ATGGAATTACTTCTACGTAAACTCGAAGAGAAATTAGATAAACAAGCCGACCAGATAACAAAGGCGGTAACTAAGAACGTCACAGAAGCTATAGACGAGAAAATAAATGCGATAATTGAAGAAAATAAACTCCTCACAAACAAAGTATCCGAACTAGAGTTGAAAATTAAATCCTTAGAAAGAGAGAAACGAAAAAACAACCTCGTCTTCTTCGGAGTAGACGAAATAGGAAAATCCGAGCGAGAATTAGTAGATTATATAAAAGATACCATAGAAGATCTAGGAGTGCAAATGAACAGCCAAGAGATTAGTAACATATATAGAATCGGAAGAAAGACGGAAAACAAAAACCGACCAGTCGTAATTTCTTTAACAACCCTGTGGAAGAAGCATCTTGTACTCAAGAACAAGTCTAATCTCCCGTCAAATATATATGTTAAAGAGGATTACTCCAAGGAAACTCTGGAAAGGCGCAAAAAACTACAATCCCAAGTGGAAGAAGAAAAAAAGAAAGAACAACACAAAGAAAAAATAGATTCATCGTCCATCAACACACTGAAAGAAATAGTAAACTCGAACAGAAGTGTCACAGAAAAATATGATCTCATGGTCACACAACTGTCAAAATTGAGGAAAGTAAATGCAACAAAAGATGTGAAGTTTGGTGCGAAGACAATGGAGCTCCTAGAAGAACGAAAAGTACTTATAACAGACAAATCAAAAACTGAAGAAAACCGTAAGTTAATATCTAAACTGAGCAAAGAGATTCGGGAAAGCATAAGAAAGGATAGGAAATTAAGAAGAACGAAAAAATTAGAAGATGAAATTCTAAGAACAGGGAGAACAAGAAAAGCTTTTAAGGAATTAAGAGAACATGGAGTGGAATGGATACCAAAACTAAAAAGCAACAGCTCCAAACAAGCAACAAATCGCAGAAAAATTCAGAGTCTTGCTACAGATTACTATCGAACTCTTTACTCGGACAATGACACCGACCGAGAAAAGACCGCCGTTAACGATCCTAGTACGAATAATAAAAAAGTACCACCAGTACTCTTGCAAGAAGTACAGAAAGCCATCATGTCTCAGAAGCCAGAAAAATCTCCAGGACCCGACAGTATATCAAATGAGCTGATTAGAGGTAACGAAGAAGAAATAAGCCCAATCCTAACCAAGCTATTCAATGATATTGTAACAACAGGTGTCATCCCAAAACAATGGAATGAGTCACATATCATCCTCCTCCATAAGAAAGGAGATAAAGATGATATTGGCAACTACAGACCAATCAGTCTAATATCAAATGTGTACAAAGTCTTCGCAAAAGTAATTCTAGAAAGAATAACAAGGGCTTTAGACGAAAACCAACCGATCGAGCAGGCAGGATTTAGAAAGAACTACAGCACTATAGACCACATCCACACAATCAAACAAGTTTTGGAAAAATACAATGAATACCAGAAGACTTTGTATATCTGCTTTATAGACTACTCCAAAGCATTTGACAGTATAAAACACAAATTTATTTGGCTGAGTCTAAAACAACAAGGAGTGGACGATATATATATAGAACTAATCAAATCCATCTACAAAAAAAGTAAAAGCAGTATTAAATTAGAGTCAAAAGGAGACCCCTTTCCAATAAACAGAGGCGTAAGACAAGGTGACCCATTATCTCCCAAGCTGTTTAATGCAGTACTGGAATGCACATTTAGAAGATTAAACTGGGATAACTATGGTATTATAATCAATGGAAGTCGCCTCAATCATTTGAGATTTGCAGATGATATTATCTTGCTAGAAGAAGATCCTAAGAAACTTGAACACATGATTAAAGAAATAGTAGAAAAAAGCAGAGAAGTAGGGCTAGAAATTAATGCAGATAAAACGAAACTAATGACGAACTCAACAGAAAGGAACATAGAGGTAAACGGAACCAAGTTCGAATATGTGAAGGAATTCGTTTACCTAGGACAAATTATATCTTCTGAAGACTCCATGTCCAAGGAAATAAACAAAAGAATAGCATGCGGTTGGAAAAAATACTGGTCCTTGAAAGAGATAATGAAGAATAAAGATCTAGGTATACATATCAAGAGAAAGACTTTCAACACTTGTATTCTCCCTTGCATGACTTACGGATGTGAGACATGGACACTAACTGACAAACATAGAGAAAAACTTGCTAAAACAGAGAGAGCAATGGAAAGAAGCATGTTGAGTATCAGACTTAGTGACAGGATTCGAAATTGGGAAATAAGAAGGAAGACAAAAGTAACGGATATAATAACTCGTATAGAAAATCTTAAATGGAGTTGGACAGGACATATGCTACGTTGCAAAAAAAACAAGTGGAGCAAACAAGTTACTTTATGGTATCCAAGAGGGGACACCAGAAGACAGGGGCGACCAAAAACGAGATGGAGCGATGATATACGCCTAACCCTAGGACCATACTGGACCAGAGTTGCAGAGGACCGAGCCCAATGGAGAGAGCTGGAGGAGGCCTATGCCACGAGGCACGCCGAACTCCGAGATATACTATAA
Protein
MELLLRKLEEKLDKQADQITKAVTKNVTEAIDEKINAIIEENKLLTNKVSELELKIKSLEREKRKNNLVFFGVDEIGKSERELVDYIKDTIEDLGVQMNSQEISNIYRIGRKTENKNRPVVISLTTLWKKHLVLKNKSNLPSNIYVKEDYSKETLERRKKLQSQVEEEKKKEQHKEKIDSSSINTLKEIVNSNRSVTEKYDLMVTQLSKLRKVNATKDVKFGAKTMELLEERKVLITDKSKTEENRKLISKLSKEIRESIRKDRKLRRTKKLEDEILRTGRTRKAFKELREHGVEWIPKLKSNSSKQATNRRKIQSLATDYYRTLYSDNDTDREKTAVNDPSTNNKKVPPVLLQEVQKAIMSQKPEKSPGPDSISNELIRGNEEEISPILTKLFNDIVTTGVIPKQWNESHIILLHKKGDKDDIGNYRPISLISNVYKVFAKVILERITRALDENQPIEQAGFRKNYSTIDHIHTIKQVLEKYNEYQKTLYICFIDYSKAFDSIKHKFIWLSLKQQGVDDIYIELIKSIYKKSKSSIKLESKGDPFPINRGVRQGDPLSPKLFNAVLECTFRRLNWDNYGIIINGSRLNHLRFADDIILLEEDPKKLEHMIKEIVEKSREVGLEINADKTKLMTNSTERNIEVNGTKFEYVKEFVYLGQIISSEDSMSKEINKRIACGWKKYWSLKEIMKNKDLGIHIKRKTFNTCILPCMTYGCETWTLTDKHREKLAKTERAMERSMLSIRLSDRIRNWEIRRKTKVTDIITRIENLKWSWTGHMLRCKKNKWSKQVTLWYPRGDTRRQGRPKTRWSDDIRLTLGPYWTRVAEDRAQWRELEEAYATRHAELRDIL

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
848
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0005
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  848
 
 

Population Genetic Test Statistics

Pi
0.12749
Theta
0.135755
Tajima's D
0
CLR
169.914063
CSRT
0.202389880505975
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号