SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11502
Annotation
PREDICTED:_uncharacterized_protein_LOC106136784_[Amyelois_transitella]
Location in the cell
Mitochondrial   Reliability : 2.873
 

Sequence

CDS
ATGAATACATTCATGTCGGGGGAGCTGCACACGTTCACCGACGCCAGCGAGAAGGCCTACGCGTGTGCAGTCTATTGGCGTCAGAAGGCAGACGAGAGCACCTACCGCGTCACGCTTCTAGCAGGGAAAGCCAGGGTGACCCCACTGAGACCAGTCTCTATCCCACGGCTGGAGCTGCAAGCTGCGCTGCTGGGGACAAGGATGGCGCAGGCGATAGCGGACGAATTGGACATCGCAGTTGGTGTAAGGACGTACTGGACTGACTCCAGTACAGTCCTGACATGGATAAAGACCGACCCGCGCACGTTCAAACCTTTCGTTGCGCACCGACTCGCCGAGATAGAAGAGTCAACGAAGCCCCAAGAATGGCGATGGGTGCCTGGCTCGCAAAACCCAGCAGACGACGCAACTAGAGAGGCGCCGGCGGATTTCGACCACACGCATCGGTGGTTTAATGGACCCGAGTTCCTGACGTGGGATGAATCGCGCTGGCCCAAGCCGCGAAAATTCAAGCAAGAACCGTCTGGAGAAGAGAAAGAGGCCTACCTGGTCGCTACGGCGAGGACCGCTGACGCTCAACCCACGCCCGATCCGCACAGATTCTCGAGCTGGGTCAGGTTATTGAGAGCAACAGCCAGGGTCCTCCAATTTATCGAGCTGTGTCGACCCCAGAAGGAGAGCGCCTGCGTGTCCAGACAATCGAAGCAGCAAGATCCCACGTGGAGGACGACACGAACGAAGCAACCCCGATCCACATGGAAGTTAAGGACCCCGGAAGCACCTACAGAAGCATGGCTGCCGCTTGATCCGCCCCACTTGAAGAAGGCGGAGAAGATCCTACTGAGAAGCAGCCAAAGAGAGAGCTTCGGTGAAAAATATCCCGAACGTCACCCCAAGTTGCGACGGCTCGACGTCGTGATGGAAGATGGCCTGTTGCGCCTGCGCGGACGTATCGACGCAGCGCAATACATAGATGCAGGCTGCAAGCGACCGATCGTGCTGGACGGGAAGCACGTGATAGCGAGATTATTGATCAAACACTATCACGAGGCGTTCCAGCACGTGGTGCAAGGTCTATCGGAGTACACCACGACTACCGCCCACCGGATACCTGCCGATAGAGCGGCTACGACATGGAGAGCCGCCGTTCACCTGTGCTGCCGTCGATTACTTCGGGCCGATGACGGTGACTGTAGGACGACGTCACGAGAAGAGGTGGGGCGTGCTGTTCACATGCCTCACCACGAGGCAGACTCAATGCTGTTAGCGCTGCGCAGGATGGCCGCCCGACGAGGAATGCCCAAAGTCATTTACAGCGACAATGGGACTAACTTCGTCGGCGCCAACAAGGAGCTCAAGCAGGCAATCGAGAATGCAAGGGAAGCAGACGTCGTGTCACGGGCCGCTCAGATGAACATAAAATGGAAGTTCATCCCGCCAGGAGCGCCGAACATGGGAGGCGCGTGGGAACGTTTGGTGCGGTCCGTGAAGACCGCGCTGGCGGTCACACTGAAGGAAAGACACCCGAGGGAAGAAGTTCTGCACACTCTTCTGTTGGAGGCGGAGCATGTCGTCAACTCGAGACCGCTCGTCGCTAGGGAAGAGAGTTGGGAGTCAGAAGCACTCACGCCGAACGACTTTCTCATAGGGAGATCCTGCGGAGCTCCGAGCATCGGCGACTACAGAGACGAAGACCTGACCGGCAAAAGGACATGGAGAGTGGCGCAGCGTATGGCGGACCACTTCTGGAGTAGGTGGGTCAAGGAATACCTGCCTACGCTGCTGCCCAGGAAGATCGACGGGAGAGCAGCTGGCGAGGACTTGCAGTGTGGGGATACCGTCCTCATAGTGGACTCCACGCTGCCACGCAACACATGGCCGCGCGGGCAAGTTGTCCACACCTACCCAGGCCCCGACCACCGTGTACGAACTGTCGACGTCAGAACGAGCGGCGGTCTGCTTAAGAGACCTGCCTCCAAGATGATCCTGCTGGTGCCTGCAACGAGCGACGAGCCCACGCCCATAGAGTCGCCACGACAAGGAGTCGGTGCTACGCACGAGGGGGAGGATGTTGGCGACAGCGGCGTCGCCCCATAA
Protein
MNTFMSGELHTFTDASEKAYACAVYWRQKADESTYRVTLLAGKARVTPLRPVSIPRLELQAALLGTRMAQAIADELDIAVGVRTYWTDSSTVLTWIKTDPRTFKPFVAHRLAEIEESTKPQEWRWVPGSQNPADDATREAPADFDHTHRWFNGPEFLTWDESRWPKPRKFKQEPSGEEKEAYLVATARTADAQPTPDPHRFSSWVRLLRATARVLQFIELCRPQKESACVSRQSKQQDPTWRTTRTKQPRSTWKLRTPEAPTEAWLPLDPPHLKKAEKILLRSSQRESFGEKYPERHPKLRRLDVVMEDGLLRLRGRIDAAQYIDAGCKRPIVLDGKHVIARLLIKHYHEAFQHVVQGLSEYTTTTAHRIPADRAATTWRAAVHLCCRRLLRADDGDCRTTSREEVGRAVHMPHHEADSMLLALRRMAARRGMPKVIYSDNGTNFVGANKELKQAIENAREADVVSRAAQMNIKWKFIPPGAPNMGGAWERLVRSVKTALAVTLKERHPREEVLHTLLLEAEHVVNSRPLVAREESWESEALTPNDFLIGRSCGAPSIGDYRDEDLTGKRTWRVAQRMADHFWSRWVKEYLPTLLPRKIDGRAAGEDLQCGDTVLIVDSTLPRNTWPRGQVVHTYPGPDHRVRTVDVRTSGGLLKRPASKMILLVPATSDEPTPIESPRQGVGATHEGEDVGDSGVAP

Summary

EMBL
AF530470    AAQ09229.1    RSAL01000375    RVE42106.1    KQ459986    KPJ18861.1    + More
AAZX01023278    LNIX01000019    OXA44812.1    LNIX01000039    OXA39294.1    LNIX01000004    OXA55408.1    OXA44855.1    LNIX01000007    OXA52015.1    OXA55241.1    LNIX01000015    OXA46575.1    OXA56250.1    JXUM01009840    KQ560293    KXJ83223.1    GAMC01017930    JAB88625.1    JXUM01130316    KQ567562    KXJ69370.1    KL367508    KFD68106.1    KL367737    KFD59786.1    GAKP01020709    JAC38243.1    AAGJ04095911    AAGJ04115911    JXUM01111221    KQ565482    KXJ70922.1    KL367480    KFD71819.1    JXUM01083542    KQ563383    KXJ73941.1    GCES01130050    JAQ56272.1    AAGJ04043389    LSMT01000554    PFX16342.1    AJWK01027898    AAGJ04040339    JXUM01038372    KQ561162    KXJ79503.1    LSMT01000016    PFX33015.1    AAGJ04001285    AAGJ04011066    GEHC01000921    JAV46724.1    KL367650    KFD60758.1    GCES01095024    JAQ91298.1    AAGJ04091218    KL367687    KFD60188.1    GCES01096813    JAQ89509.1    RSAL01000010    RVE53755.1    AAGJ04152028    HAEF01019456    SBR60615.1    AAGJ04173907    AAGJ04146728    AAGJ04146729    AAGJ04141734    LSMT01000699    PFX15001.1    AAGJ04122915    HAEJ01004007    SBS44464.1    AERX01020956    GCES01107353    JAQ78969.1    KL367515    KFD67336.1    GBYX01453073    JAO28442.1    HAEJ01014775    SBS55232.1    AAGJ04162434    KFD67354.1    JYDM01000241    KRZ82930.1    JYDM01000403    KRZ82016.1    JYDI01000018    KRY58771.1    MRZV01000643    PIK46464.1    LSMT01000268    PFX21664.1    AJVK01033431    AJVK01037041    GCES01140316    JAQ46006.1    KL363318    KFD47687.1    JXUM01162450    KQ574455    KXJ67869.1    JXUM01005801    KQ560202    KXJ83866.1   
Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF05585   DUF1758
PF17921   Integrase_H2C2
PF01565   FAD_binding_4
PF09129   Chol_subst-bind
PF00628   PHD
PF00078   RVT_1
PF06677   Auto_anti-p27
PF00069   Pkinase
PF13516   LRR_6
PF18738   HEPN_DZIP3
PF05729   NACHT
PF10607   CLTH
Interpro
IPR040676   DUF5641        + More
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR041588   Integrase_H2C2       
IPR008737   Peptidase_asp_put       
IPR001995   Peptidase_A2_cat       
IPR001878   Znf_CCHC       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR001841   Znf_RING       
IPR019786   Zinc_finger_PHD-type_CS       
IPR000477   RT_dom       
IPR019787   Znf_PHD-finger       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR011011   Znf_FYVE_PHD       
IPR009563   SSSCA1       
IPR036305   RGS_sf       
IPR000961   AGC-kinase_C       
IPR000719   Prot_kinase_dom       
IPR000239   GPCR_kinase       
IPR017441   Protein_kinase_ATP_BS       
IPR011009   Kinase-like_dom_sf       
IPR016137   RGS       
IPR036875   Znf_CCHC_sf       
IPR032675   LRR_dom_sf       
IPR027417   P-loop_NTPase       
IPR007111   NACHT_NTPase       
IPR001611   Leu-rich_rpt       
IPR041249   HEPN_DZIP3       
IPR013087   Znf_C2H2_type       
IPR006594   LisH       
IPR006595   CTLH_C       
IPR024964   CTLH/CRA       
IPR021109   Peptidase_aspartic_dom_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       
SSF56112   SSF56112       
SSF48097   SSF48097       
SSF57756   SSF57756       
SSF52540   SSF52540       

Ontologies

Topology

Length:
698
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00018
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00008
outside
1  -  698
 
 

Population Genetic Test Statistics

Pi
279.659573
Theta
171.922653
Tajima's D
1.985575
CLR
0.605367
CSRT
0.88025598720064
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号