SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11501
Pre Gene Modal
BGIBMGA011048
Annotation
PREDICTED:_uncharacterized_protein_LOC105700222?_partial_[Orussus_abietinus]
Location in the cell
Nuclear   Reliability : 3.843
 

Sequence

CDS
ATGGTAAATACCCGCAGTACCGCCAACAAACAAAGAAAAATTGACGATGAGCATGACGCAAAAAGTTCTTGTGCCGCGAGTGCAGTGAAATCGGAACGAACCGAAAAACAAAATCCGCCTTCACTAGCATCACGTCAGTCAGTCAGGTCCAAGAAAATGTCATCATCAAAATCAATACAAATCCAGAAAAAGAAACTGGAACTAGAAGCAGCTCAGGCGAAAGCGCGTATTCAAATGGAACTCATTGATCAAAAATTAGCGACGGATCTAGCAGAACTCGAAGAAGAATACAGTCCACCATCAGAAATATCGGAGAAAAACAACGGCGGTGATATAGAAAAATGGTTAGAGCGTAGTCAACAGGAACTGCAGCAGGCCACTAAGCTCAACAGTGATACACACAAGTCACACTCAAGCCCGGCCGACAACGACGCAGTTCAACAACTCACGAGCGCATTCAAAGAATTTATGACGTCCTCCGCCATCCAGCAAAATACTAAGCTGCTCAGTCGTCTCAGCACTCCAAAAGAACTCCCTATCTTCAGCGGAGATCCAAAAGAATGGCTTCATTTCGAGCAGGCCTACCTGGAATCGACTGAAGTCTGCAACTTCAGCGATAAAGAAAACCATTGGCGGTTACGAAAGTGTTTACGAGGTACCGCACAAGAAGCCGTCGCCGGCCTACTTATCAGTGGTGCTTCTCCTGCAGAAATAATTTCCACTTTAAAACTACAGTTCGGAAACGCTGACGTCATCCTATCTCGCATCGTGGTAGACGTAAAGAAGATGAACCCACTGCCTATGGACTACCACAAAGAAATAGTACCCTTTTCAGGAAAAGTGAAAAATTACGTGGCCGCTGTACGAGCCCTTGGTCGCCAAGAGTACCTGCAAGGCATGGAAGTGGCTAACATTATCTTATGCAAGCTACCCACGACCCTGCTCACCAAGTGGACAGATTATAGTTATCCGCTTATCACAGCTGAATCGCCGAAACCTAGACTAGAGGTGCTGTCAGATTTCCTCACCGAAGAAGCTGTAAAAGTATCAACCTGTAGTGCTACTTTATTGCAATCTAGGACGGACAATTTCAAACGTAAACTTTATGATAAAGTGAACAATATACAAACAATTTTAGTGCAAGACGGACAAAGTGTACAAAAATGTGGTTATTGTCGTACCGGTAGCCATAAATTAACTGAGTGTAAAAAATTTAAAAAATCACTAAGAAAGGACAGATGGTTCCATGTGAAGCGTTACGGCATTTGTTATAAGTGTTTATTAGCGCATCATCGCAGGGAAACGTGCTCCGCTCCAAGCTGTGACGTAAGCAATTGTGGACAATCGCATCACCGCTTACTGCATTATGTGCCGAGTCGAAACGACACTCAATCTGTATCAGCAGTAGAAGTTCAGTCTGAAATAGTAACAAATATTAATGTCGGCTGTTCCGTAATGTTAAAAATTGTGCCTATAAATATTCACGGACCGAACGGAATTGTTAGCACGACCGCCTTGCTCGACGATGGCTCGACTGTGTCGTTGATTAGCGCTCCGCTGGCATTACAAGTGGGACTGCGCGGCCGCCACGAACGTCTTCGTGTGCGCGGCGCGTGGAACGATACAGAATTAGTGTGCGATGCGCAGCTAGCAAACGTGACACTGTGTAGTAAGTGTAGTACCGATAACAAGATGTTTACAATCGATGCGCGGATTGTCGAAGAGTTAAACCTACCACAAAGTTTGCCTACAGTAAATGTTAAAAAATATTTGCACCTAAATGACATCAGCCATAACTTATGCACCACAACACAACTGCATCCGCAAGTTTTAATTGGACAAGATAATTGTCATCTCCTCTTACCTCTGGAAATGAGAGTGGGTAAGCCCGATGAACCCTGTGCCACCCGGACTCCTCTGGGTTGGTGCCTCCATGGAAGAGTACCTAATGCTTACCTACCTAATTCTGCTGCACGTCACACTTCATTGTTTGTCTCCAGTGACGTCATAGAATCTGAATGTACTTTGCGAGAGATCCACGAGGAGGTGCGAAGATCGTTCTCAATCGAGTCCATGGGCGTGTCTGGCAAACCAAGACAGAACTCAGAAGATTTACGCGCTGTTGAAATTTTAGAACGAACCTCCACTCTCGTCAATGATCAATGGCATGTTGGCTTACCTTGGCGGGATGAGACTTGTACGATGCCGGACTCGTACCTAACAGCTCTCCGTAGACTAAAAGGAGTCGAACAAAAATTAAAAAATAACAAAGAATATGCAAAAAGATACGAAGAACGAATACGACATTTATTTGAAAATGATTTCGCAAAAAAACTGATCAGCTCAAATGTTACACCGCTGAAAACTTGGTATTTACCTCATTTTGGTGTCGATAACCCGAACAAAAAGAAACTGCGCTTAGTGTTTGACGCCGCGGCCAAAACAAACGGTTTGTCCCTGAATGATTACTTATTGAAAGGGCCCGACCTACTAATGTCATTATTCGGCATCATGTTGCGATTTAGAGAAAATCGTATAGCTGTTTCTGGAGATATTAAAGATATGTTTCTCAAAGTGAAGATTCGACCAGAAGACCAGGATGCCTTCCGTTTTTTATATAGAGAAGAACCGGAGGGAAATATAAACACTTACGTTATGACGTCATTAATTTTTGGTGCTAATTGTTCGCCATTTATAGCTCAGTTTGTAAAAAATAAAAACGCTCAGCGGTATGAGTCATCAATGCCCGCTGCTGCTTCCGCTATATATAGAAGTCACTATATGGACGATTATATAGATAGTCTACCTAACGAGGAGGCCGCAATACAATTAATTCACAACATTATGTTTATTCACAAGCAAGGCGGGTTCCAGATGCGGAATTGGACGAGTAATAGTAAAAAAATACTCGCGAGCCTACCTAAAGATTTATTGGGCGAAGCAGCTGTTAAATTTAATACAGGTCAACTGTATGAAGGCGAACGCACGCTTGGATTGATTTGGCATCCAAATGATGATACTCTCAGATTCGACGTGTCTTTCAAGCGGATACCCGAAACTATTATAAACGGAACTCAAAAGCCAACCAAGAGAGAAATGTTACGCGTGATTATGTCCATTTTTGACGTTTATGGCATTCTAGCACCGTTCACCATAAATGGAAAAATTATGCTACAAGAAATTTGGAAATCTAAAATAAGCTGGGATGATTACATAACCGAAACGGTATTCCAGAAATGGTTGAAATGGATTTATCTTCTGGAATCATTAAAAGACCTGAGTTTGCCGAGGTACTATCCGGCTGCTACCATACGAGTGAATGAGACGAATAATGAAACCCTTCCGCTGTCATACTCACACAGCACGATTTCTAGGACTACGGCTACGAATAATGCTACGAGCGTAGCACACGCCGAATCCGCTACGAATACTGCATCGCACAGCTACAATAATAATTGTGGAGACGATTGCAGTGGAGTTTTAACTCGAACTGGCTATAGAAACTTACAGATGCATATATTTTGTGATGCGTCTAACAAAGCATACTGCGCCGTCGCGTACTGGAGATGGATTGACGACGAGTTTAACATACGCGTAGCATTCATTGCGAGCAAATCTCGAGTTGCAGGAAACAAACCTATTACCATCCCACGTTTGGAACTTCAAGCCGCCGTCTTAGCGGCAAGACTAGTGGACTCAGTCACTAGAGAACATATTATAAAGCCTGAGCAACGAATATTTTGGAGCGACTCGACGACAGTGCTGCAATGGATAAGAAATGATGCTCGCGACTATAAAGTTTATAAACAAATGCAAGAAGCTTACCTTTGA
Protein
MVNTRSTANKQRKIDDEHDAKSSCAASAVKSERTEKQNPPSLASRQSVRSKKMSSSKSIQIQKKKLELEAAQAKARIQMELIDQKLATDLAELEEEYSPPSEISEKNNGGDIEKWLERSQQELQQATKLNSDTHKSHSSPADNDAVQQLTSAFKEFMTSSAIQQNTKLLSRLSTPKELPIFSGDPKEWLHFEQAYLESTEVCNFSDKENHWRLRKCLRGTAQEAVAGLLISGASPAEIISTLKLQFGNADVILSRIVVDVKKMNPLPMDYHKEIVPFSGKVKNYVAAVRALGRQEYLQGMEVANIILCKLPTTLLTKWTDYSYPLITAESPKPRLEVLSDFLTEEAVKVSTCSATLLQSRTDNFKRKLYDKVNNIQTILVQDGQSVQKCGYCRTGSHKLTECKKFKKSLRKDRWFHVKRYGICYKCLLAHHRRETCSAPSCDVSNCGQSHHRLLHYVPSRNDTQSVSAVEVQSEIVTNINVGCSVMLKIVPINIHGPNGIVSTTALLDDGSTVSLISAPLALQVGLRGRHERLRVRGAWNDTELVCDAQLANVTLCSKCSTDNKMFTIDARIVEELNLPQSLPTVNVKKYLHLNDISHNLCTTTQLHPQVLIGQDNCHLLLPLEMRVGKPDEPCATRTPLGWCLHGRVPNAYLPNSAARHTSLFVSSDVIESECTLREIHEEVRRSFSIESMGVSGKPRQNSEDLRAVEILERTSTLVNDQWHVGLPWRDETCTMPDSYLTALRRLKGVEQKLKNNKEYAKRYEERIRHLFENDFAKKLISSNVTPLKTWYLPHFGVDNPNKKKLRLVFDAAAKTNGLSLNDYLLKGPDLLMSLFGIMLRFRENRIAVSGDIKDMFLKVKIRPEDQDAFRFLYREEPEGNINTYVMTSLIFGANCSPFIAQFVKNKNAQRYESSMPAAASAIYRSHYMDDYIDSLPNEEAAIQLIHNIMFIHKQGGFQMRNWTSNSKKILASLPKDLLGEAAVKFNTGQLYEGERTLGLIWHPNDDTLRFDVSFKRIPETIINGTQKPTKREMLRVIMSIFDVYGILAPFTINGKIMLQEIWKSKISWDDYITETVFQKWLKWIYLLESLKDLSLPRYYPAATIRVNETNNETLPLSYSHSTISRTTATNNATSVAHAESATNTASHSYNNNCGDDCSGVLTRTGYRNLQMHIFCDASNKAYCAVAYWRWIDDEFNIRVAFIASKSRVAGNKPITIPRLELQAAVLAARLVDSVTREHIIKPEQRIFWSDSTTVLQWIRNDARDYKVYKQMQEAYL

Summary

EMBL
GEZM01052588    GEZM01052587    GEZM01052586    JAV74402.1    LNIX01000015    OXA46575.1    + More
JXUM01136032    KQ568367    KXJ69026.1    NWSH01005440    PCG64209.1    LNIX01000019    OXA44855.1    AF530470    AAQ09229.1    LNIX01000003    OXA57597.1    LNIX01000039    OXA39294.1    JXUM01005879    KQ560203    KXJ83865.1    RSAL01000375    RVE42106.1    LN877231    CTR11689.1    JAV74399.1    JXUM01034199    KQ561015    KXJ80028.1    LNIX01000004    OXA55241.1    JAV74401.1    LNIX01000007    OXA52015.1    JXUM01127084    KQ567147    KXJ69602.1    GEHC01000967    JAV46678.1    GEHC01000914    JAV46731.1    GEHC01000955    JAV46690.1    GGFL01001682    MBW65860.1    GEHC01000947    JAV46698.1    JXUM01111221    KQ565482    KXJ70922.1    GDHC01018323    JAQ00306.1    GAMC01017930    JAB88625.1    GGFJ01000402    MBW49543.1    GGFJ01000401    MBW49542.1    OXA55408.1    GGFL01001842    MBW66020.1    GGFL01005193    MBW69371.1    D83207    BAA57030.1    GGFK01002641    MBW35962.1    GGFK01002609    MBW35930.1    GGFK01002619    MBW35940.1    GGFK01002635    MBW35956.1    GGFK01002631    MBW35952.1    GEHC01000945    JAV46700.1    GGFL01001727    MBW65905.1    GEHC01000872    JAV46773.1    GGFJ01000302    MBW49443.1    GGFJ01000218    MBW49359.1    AB110069    BAD01589.1    BAD01590.1    JXUM01130316    KQ567562    KXJ69370.1    ADMH02001934    ETN60411.1    GDUN01000090    JAN95829.1    LNIX01000027    OXA41945.1    JXUM01038372    KQ561162    KXJ79503.1    OXA56382.1    GEHC01000956    JAV46689.1    GGFK01008809    MBW42130.1    GGFJ01000935    MBW50076.1    GGFJ01000432    MBW49573.1    GEHC01000921    JAV46724.1    GGFJ01000306    MBW49447.1    GGFJ01000487    MBW49628.1    GGFJ01000470    MBW49611.1    GGFJ01000471    MBW49612.1    GGFK01009497    MBW42818.1    GGFJ01000333    MBW49474.1    KL367585    KFD62883.1    LSMT01000554    PFX16342.1    LSMT01001301    PFX12555.1    NIRI01000132    RJW72731.1    AAGJ04141734    JYDO01000345    KRZ65499.1    AAGJ04173907    JYDM01000385    KRZ82062.1    AAGJ04043389   
Pfam
PF05380   Peptidase_A17        + More
PF03564   DUF1759
PF18701   DUF5641
PF17921   Integrase_H2C2
PF00665   rve
PF01565   FAD_binding_4
PF09129   Chol_subst-bind
PF05585   DUF1758
PF00628   PHD
PF00078   RVT_1
PF01048   PNP_UDP_1
PF13855   LRR_8
PF18738   HEPN_DZIP3
Interpro
IPR005312   DUF1759        + More
IPR008042   Retrotrans_Pao       
IPR040676   DUF5641       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR001878   Znf_CCHC       
IPR012337   RNaseH-like_sf       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR019786   Zinc_finger_PHD-type_CS       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR008737   Peptidase_asp_put       
IPR002999   Tudor       
IPR000477   RT_dom       
IPR001841   Znf_RING       
IPR000048   IQ_motif_EF-hand-BS       
IPR000253   FHA_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR003961   FN3_dom       
IPR035994   Nucleoside_phosphorylase_sf       
IPR000845   Nucleoside_phosphorylase_d       
IPR032675   LRR_dom_sf       
IPR001611   Leu-rich_rpt       
IPR041249   HEPN_DZIP3       
IPR003591   Leu-rich_rpt_typical-subtyp       
SUPFAM
SSF53098   SSF53098        + More
SSF57903   SSF57903       
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF53167   SSF53167       

Ontologies

Topology

Length:
1276
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.40149
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00407
outside
1  -  1276
 
 

Population Genetic Test Statistics

Pi
274.217314
Theta
231.8617
Tajima's D
0.979991
CLR
0.018785
CSRT
0.649567521623919
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号