SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11500
Annotation
hypothetical_protein_M514_27221_[Trichuris_suis]
Location in the cell
Nuclear   Reliability : 3.772
 

Sequence

CDS
ATGGATAAATACAACCCAGATACATTCAGAATTGACGATTACATTGATTTTTTCGAAAACAAATGCAAAATTCTTGATATCGATAACAGCGACTTACAGAAAGATTTGCTTCTGAATTTACTAACACCAGAGATATTCCAGGAATTAAAAGTAGCTTTAACGCCTGATTTCGATATAGCTACATACAGCGAAATTTGTAACAAATTATTAGACCTCTATCGCATAAAAACGACGAGTAATAACGAGGAAGAAAGCGATGATGAAGTTATCTGCAGCGTCTTGGGTACACGTAAGAGAGAATGCAAACAAATCGATGTACGGATCAATGGCATACCTTGCACTATGGATTGGGACCCCGGCTCTGCGTATTCAATAATAAACACGACATTGTGGAAAAAATTAGGATCACCATCTTTACAACCCGCCCCGAAACTTAAGGCCTACGGCAACACAAACTTAAAAACAAAGGGAATTACAAAAGTGACAGTCGAAGTCGACGGACTGCAAAAACTTCTACCTGTGGTCGTAATGAAAAATGCCAAACCAATGTTATTTGGTTTACATTGGAGTGAAGTTTTTGAAATGGAATTTCCAAAACCAGTATACTCCATCAAAACATCAATACTGATTACTCTTAAACAAATACTGGATAAACATTCACAACTCTTTGATGGAAAACTAGGAAAAGTTAACAATTATTACGTAAACATACATGTCAAACCAGAAGCTGAACCGATCCACCTTCCTGCACGGCCTATAAAATTCAGCATGAAAAAGAATATAGAAAGGGAGATAGATCGTCTGATCTCAGAAGGGATAGTGGAAAAAGTAGATCCTAATATTACACCTATTGAATGGGCTACACCCACAGTTAACATTCTGAAATCTACAGGGGAAGTTAGGATATGTGGAGACTACAGAACTACACTTAATCCAGTACTTATTAAACATCTACACCCAGTTCCAATTTTCGATCAACTACGCCAAAATCTCGCAAACGGTAAATTATTTTCAAAAATAGACCTTAAAGACGCATACTTACAATTTGAAATAGCACCGGATTCGAAAAAGTACTTGACGTTGTCAACACATAAAGGGTATTTCCAATACAATAGAATGCCTTTTGGAATACCGACTGCTCCTTCAATTTTCCAACATTTTCTGGATCAACTGCTAGGCGATATCACCAATGTAGCTGTATATTTTGACGACATAGCTATAGCAGGGAAAGATCTTTCAGAACATTTACAAACTTTATCTATTGTATTCGATCGCTTACAAAACGCTGGCCTAAAAGTTAATTTAAAGAAATGTAATTTCTTACAGAATCAGATTGAATACCTAGCATGTGACGCTTCCGAAAAGGGATTGGGTGCAGTATTATTCCACAAGGACTCGAACATAGAACAACCAATTGCTTTTGCTTCAAGGAAACTACGACCAGCGGAAATGAAATATTCCGTTATTGATCGTGAAGCTTTAGCAATAGTATTTGGTATAAAAAAATTTGATCAGTACTTGAGAGGAACGAAATTTAATCTAGTTACGGACCATAAGCCTCTTATACATATTATGGGTGCACGCCGCAACCTTCCTAAACTAGCCAATAACCGATTGGTAAGATGGGCTCTAGTAGTGGGAAGTTATCAATATGACATTTACTACAGGAAAGGTGAAAATAACACATTAGCTGATTGCCTTTCCAGATTACCAAACCCTGAAACGGAACCCTCCGAGATAGAAGGGCTTGTACATAAAATAGAACTACGTCTTTTGAGCACTCGAATGACTGACCTTAACCTATCAGAACAGTTACTTATGAAAACAACTGCAAAGGATCATATACTCACAAAAGTTTGTCAAAATTTAAAAACCGGCTGGAGAGAATCAGAATACAACCCAGAAATGAAACCATTCTACAGAAACCGGGCTGAATTATCTGTTGAGAATAAGATACTTATGAGGCAAGGACGCATCGTTATACCTACAGCACTCCGAAAAGCCATTCTTACATACCTTCATCGAGGACATCCTGGCATTTCTGCTATGAAAGCACTTTCACGTTACTATGTTTGGTGGCCTAACCTTGACGAAGACATAGAATTATTTGTCAAGAAATGTACCAGATGCCAACAGAACCGCCCTTGTAATCCTGAACTTCCTGTATTTTCCTGGTCCATACCAGAAGAAGTATGGGAGAGAATCCATATCAACTTTGCTGGACCGTTCGAAGGATCGTATTGGTTGGTATTGTGCGACGCTCTCTCCAAATGGGTGCAAATACGACCGATGAAACACATCAACACCAGATCACTTTGTCTTACATTAGATAACATATTTTGTACATTTGGCTTACCAAAAATGATTATATCCGATAATGGACCTCAATTTACATCTTATGAATTTAAAGAATATTGCACAAAACAGTCTATTTTACATGTCACATCATCTCCATATCATCCTCGGACAAATGGGCTGGCAGAACGTTTAGTCAGAACATTCAAAAATAGAATGGCATCGGTAGACAACACAAATCTCGAGCGCCGACTATTAGAATTTTTGTTTACATACAGAAACACTCCGCACTCGTCCACTGGTAAATCTCCAGCTGAGATGATGTTTGGAAGACAATTGAATTGCATACTTTCCAACATTCGGCCAGACAAAAGAAGATTAATGCAGTATTTACAAGTAAAAGAAAATATTCGTACCACATCACCGAGTTACCGACCAAGTGACCAAGTATATATTAAAACACGCAATGATAAAATATGGGAACCAGCGGTAATTACATCCCGAAAACATAAATATTCATATATTGTTTCAACACCAGGAGGACTAGAAAAACGAAGACATGCTGATCACATCAGGCCACGCGAGTCCTCCACCTCAGAAACCCCGAGGAATGAAAGGGCACATTCTTCTATGCTGGCGGCGACTGCTTCTCCAGACATTGGAATGGAAACAACAATTAGCGAAAGGCTAACTAAAAACAAGAATTCGGCAGCAGTACCATTACCTACACCGCAGTCGCCTACAAATGTACAAATTTCTCCAAATTCACCTTCACAGTATTCGCAATTATACTCCTCACCTGCTCCGGTCTCCACTCCTGTGCCATTTGCTCCGCGTCGAAGTAATCGACGTATACAGGCACCCCGCCGTCTGATCAACGAGATGTAG
Protein
MDKYNPDTFRIDDYIDFFENKCKILDIDNSDLQKDLLLNLLTPEIFQELKVALTPDFDIATYSEICNKLLDLYRIKTTSNNEEESDDEVICSVLGTRKRECKQIDVRINGIPCTMDWDPGSAYSIINTTLWKKLGSPSLQPAPKLKAYGNTNLKTKGITKVTVEVDGLQKLLPVVVMKNAKPMLFGLHWSEVFEMEFPKPVYSIKTSILITLKQILDKHSQLFDGKLGKVNNYYVNIHVKPEAEPIHLPARPIKFSMKKNIEREIDRLISEGIVEKVDPNITPIEWATPTVNILKSTGEVRICGDYRTTLNPVLIKHLHPVPIFDQLRQNLANGKLFSKIDLKDAYLQFEIAPDSKKYLTLSTHKGYFQYNRMPFGIPTAPSIFQHFLDQLLGDITNVAVYFDDIAIAGKDLSEHLQTLSIVFDRLQNAGLKVNLKKCNFLQNQIEYLACDASEKGLGAVLFHKDSNIEQPIAFASRKLRPAEMKYSVIDREALAIVFGIKKFDQYLRGTKFNLVTDHKPLIHIMGARRNLPKLANNRLVRWALVVGSYQYDIYYRKGENNTLADCLSRLPNPETEPSEIEGLVHKIELRLLSTRMTDLNLSEQLLMKTTAKDHILTKVCQNLKTGWRESEYNPEMKPFYRNRAELSVENKILMRQGRIVIPTALRKAILTYLHRGHPGISAMKALSRYYVWWPNLDEDIELFVKKCTRCQQNRPCNPELPVFSWSIPEEVWERIHINFAGPFEGSYWLVLCDALSKWVQIRPMKHINTRSLCLTLDNIFCTFGLPKMIISDNGPQFTSYEFKEYCTKQSILHVTSSPYHPRTNGLAERLVRTFKNRMASVDNTNLERRLLEFLFTYRNTPHSSTGKSPAEMMFGRQLNCILSNIRPDKRRLMQYLQVKENIRTTSPSYRPSDQVYIKTRNDKIWEPAVITSRKHKYSYIVSTPGGLEKRRHADHIRPRESSTSETPRNERAHSSMLAATASPDIGMETTISERLTKNKNSAAVPLPTPQSPTNVQISPNSPSQYSQLYSSPAPVSTPVPFAPRRSNRRIQAPRRLINEM

Summary

Pfam
PF00665   rve        + More
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17921   Integrase_H2C2
PF17917   RT_RNaseH
PF05147   LANC_like
Interpro
IPR041588   Integrase_H2C2        + More
IPR036397   RNaseH_sf       
IPR000477   RT_dom       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR041373   RT_RNaseH       
IPR001878   Znf_CCHC       
IPR021109   Peptidase_aspartic_dom_sf       
IPR012341   6hp_glycosidase-like_sf       
IPR020464   LanC-like_prot_euk       
IPR007822   LANC-like       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
Gene 3D
PDB
4OL8     E-value=8.58198e-25,     Score=286

Ontologies

Topology

Length:
1060
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00296000000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00012
outside
1  -  1060
 
 

Population Genetic Test Statistics

Pi
389.730605
Theta
225.163758
Tajima's D
2.105156
CLR
0.138711
CSRT
0.898705064746763
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号