SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11492  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA001913
Annotation
thrombospondin_type-1_domain-containing_protein_4-like_precursor_[Bombyx_mori]
Full name
ADAMTS-like protein 4      
Alternative Name
Thrombospondin repeat-containing protein 1
Location in the cell
Extracellular   Reliability : 3.424
 

Sequence

CDS
ATGGTAGTTGGCCGCGAAGGTGTTCTAGCCTCGTCTTCTGAGAGAGAACTAAGATGTGGAAGTCGTCTTGTGTCAGGACTATTCTCGAAGCCACGACTCCCGCTCGGATACTCTTACGTAACGACAGTGCCTCGTGGAGCATGCCGACTCAATGTAACTGAAGTAGTTCCTAGCGAAAACTACATTGCATTAAAAGAATCCAATGGCACGTACATTATAAATGGGGAGTTTGCTGTGAGTGCGCCTGGAACTTACGATGTTGCTGGAGCCCGATTTTTATACACCCGAACGGCCAGTCTTGACGGCATTTTTGCTGTGGGTCCGATACATAAACCCATTGACATAATGATATTATACACACAACCAAACCCGAATATTAGGTACGAATATTTAACTGACACGGAAGATGAAACCAGTAACGACATTCCGACTTCAATGCCTCCCGCCCATCACCAGATGCAGAGGCATCACCGTCACCACCCACCACCCCATAGCTTGCCCAGAACAGATTCTTCTATATCGAAGGAATCAAATTTCTATAGCCTTGAAAGCCAATCACAAGCGGAAAGTAACGTGATCGGAGATAGGAAATTTATGTGGAAAATTATGTCTTTCACCCCGTGCTCTCGTACCTGTGGCGGAGGACTACAAATCGGAAAGTTCAAGTGTGTAGAAGTTGGTTTAAAAGAAGACAAAGAGGTATCTCCAGTGCATTGTACTGGTGCGGCACCACCTTCCCGCCGACGGAGGTGTTCTGGGGCTCCATGTCCTCCCCGTTGGAGGGCTGCAGCGTGGGGTCCTTGTCCGGTCTGCGGACCAGCCCACAGAACTCGAATTGTGGGATGTGTTCAGGATCATGCTCGAGGAATTATCAAGATAAGCGATCAAAAGTGCCCATTGCCAATGCCACCAAGCAGTGAGCGCTGTAATGTTCCAAACTGCGATGGCTCAGTAACTACCACAGCTTTGCCACGTCTCGATTCACGACGCCAAGTACGACCAAAAGATCGAACGGATCATTTCCGAGAAGGCCCTGTTATAACTCTTGCAACAAATTTAACAGACAATGAGATTACTTCCACTCCGCCCACTTCGTATAGTTTCAGTGCTGGTGGAGGCTGGTTATATACGGAATGGTCCGAGTGTGTTGGTTGGTGTGTGGGCGGCGGTGTACAATCTAGAGGAGTAAGATGCGCCGATCCTTCTGGATGTTCATCGCACCGTGCACCATTGCCTACTCAAGCTTGTAGCGTGCGAAGCCAATGCGATTCTCAATGGTTCACAAGCGAATGGTCAAAGTGCTCCGCTGGATGCGGTGGCCGACAGGTTCGAGGCGTGATATGTATTGGAGGGAACGGCAGGAGATTAAGAGATTCGGCATGTAGAGGAACCAAACCTGAAACTGAAAGGGACTGTGGTGGGGACTGCTCTCCCTCTTGGTACTTGAGTGACTGGAGCGAGTGCAAAGGTCCCTGTGAAGCTGGAGTCCAGTCCCGAACTGTCTGGTGTGCCCGTGGCGGAATCGAAGGAGCAAACGGTGCCGCTCGAGACGGAGAATGTCCAGGAGTGAGGCCTCCAGCAAAGAAAATGTGTGTACCAGCACGATGTACCAGCAAACCAGTTATCAATCCAAACGTTATCAGTCCTCCAGCAGTTTCAGATCCTCAGCAGCGCGTTACGAGACATCAAATCAATACCCCTCCACATATCAGGGATAGGTCATATGCTGACGGAGCATGTGTAGACAAATTGAATACATGTGCATTAGCGGTACAGGCACGTCTGTGCCACTACCCTTACTACGCAGACAATTGTTGCGACTCTTGCCATGGACGGTAG
Protein
MVVGREGVLASSSERELRCGSRLVSGLFSKPRLPLGYSYVTTVPRGACRLNVTEVVPSENYIALKESNGTYIINGEFAVSAPGTYDVAGARFLYTRTASLDGIFAVGPIHKPIDIMILYTQPNPNIRYEYLTDTEDETSNDIPTSMPPAHHQMQRHHRHHPPPHSLPRTDSSISKESNFYSLESQSQAESNVIGDRKFMWKIMSFTPCSRTCGGGLQIGKFKCVEVGLKEDKEVSPVHCTGAAPPSRRRRCSGAPCPPRWRAAAWGPCPVCGPAHRTRIVGCVQDHARGIIKISDQKCPLPMPPSSERCNVPNCDGSVTTTALPRLDSRRQVRPKDRTDHFREGPVITLATNLTDNEITSTPPTSYSFSAGGGWLYTEWSECVGWCVGGGVQSRGVRCADPSGCSSHRAPLPTQACSVRSQCDSQWFTSEWSKCSAGCGGRQVRGVICIGGNGRRLRDSACRGTKPETERDCGGDCSPSWYLSDWSECKGPCEAGVQSRTVWCARGGIEGANGAARDGECPGVRPPAKKMCVPARCTSKPVINPNVISPPAVSDPQQRVTRHQINTPPHIRDRSYADGACVDKLNTCALAVQARLCHYPYYADNCCDSCHGR

Summary

Description
Positive regulation of apoptosis. May facilitate FBN1 microfibril biogenesis (By similarity).
Subunit
Interacts with CTSB. Interacts with FBN1 (By similarity).
Keywords
Apoptosis   Complete proteome   Extracellular matrix   Glycoprotein   Reference proteome   Repeat   Secreted   Signal  
Feature
chain  ADAMTS-like protein 4
EMBL
BABH01017965    BABH01017966    JN701183    AEY78648.1    NWSH01000085    PCG79775.1    + More
ODYU01003223    SOQ41695.1    KQ461073    KPJ09706.1    KQ458575    KPJ05723.1    AGBW02004790    OWR55370.1    JTDY01006868    KOB65631.1    ODYU01006251    SOQ47921.1    KPJ05721.1    PCG79780.1    OWR55369.1    KPJ09707.1    BABH01017967    JTDY01004531    KOB68038.1    KZ288321    PBC28238.1    KQ772519    OAD52442.1    GEDC01021748    JAS15550.1    KQ414782    KOC61181.1    GEZM01071486    JAV65765.1    KK107139    EZA57658.1    LJIG01009642    KRT82671.1    QOIP01000003    RLU24431.1    GL888624    EGI58913.1    KQ983045    KYQ47910.1    KQ981856    KYN34465.1    GEDC01006443    JAS30855.1    KQ976490    KYM83398.1    GEDC01018976    JAS18322.1    KQ971354    KYB26305.1    GL451079    EFN80139.1    KQ978081    KYM97096.1    KQ978782    KYN28460.1    KK852607    KDR20349.1    GL732525    EFX88574.1    GEDC01003744    JAS33554.1    ABLF02030672    ABLF02030674    CVRI01000038    CRK93983.1    GGMR01006578    MBY19197.1    UFQT01000002    SSX17113.1    SSX17112.1    KK107499    EZA49788.1    RLU24509.1    JXUM01013697    JXUM01013698    JXUM01013699    JXUM01013700    JXUM01013701    JXUM01013702    JXUM01013703    KQ560383    KXJ82683.1    KQ414617    KOC68227.1    AJWK01017317    KB200049    ESP03329.1    AXCN02001960    AXCN02001961    GL888575    EGI59403.1    GFDF01000898    JAV13186.1    BC099119    AAH99119.1    RJVU01050255    ROL42153.1    AJWK01033098    GAMC01011436    JAB95119.1    GAMC01011435    GAMC01011434    JAB95120.1    AEMK02000022    GBRD01004470    GBRD01004469    GDHC01004985    JAG61351.1    JAQ13644.1    LSMT01000002    PFX34779.1    AY158701    BC117925    AAI17926.1    AAO17738.1    GDHC01017670    JAQ00959.1    AEFK01176859    AEFK01176860    CH916372    EDV98982.1    CYRY02013529    VCW84113.1    GABZ01003954    JAA49571.1    DQIR01259078    HDC14556.1    JH170305    EHB08602.1    LZPO01027203    OBS79198.1   
Pfam
PF05986   ADAM_spacer1        + More
PF08686   PLAC
PF00090   TSP_1
Interpro
IPR036383   TSP1_rpt_sf        + More
IPR000884   TSP1_rpt       
IPR010294   ADAM_spacer1       
IPR010909   PLAC       
IPR011257   DNA_glycosylase       
IPR013273   ADAMTS/ADAMTS-like       
IPR003582   ShKT_dom       
IPR017985   MeTrfase_CN4_CS       
IPR013087   Znf_C2H2_type       
SUPFAM
SSF82895   SSF82895        + More
SSF48150   SSF48150       
Gene 3D

Ontologies

Topology

Subcellular location
   Colocalizes with FMN1 microfibrils in the eye ECM.   With evidence from 1 publications.
Length:
612
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01401
Exp number, first 60 AAs:
0.00058
Total prob of N-in:
0.00093
outside
1  -  612
 
 

Population Genetic Test Statistics

Pi
27.552449
Theta
161.024526
Tajima's D
-1.386394
CLR
2792.046968
CSRT
0.0786960651967402
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
27102218 DGECPGVRPPAKK 100.00 7e-09
27102218 ITPEKVEMATITR 100.00 0.019
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号