SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11490  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA001906
Annotation
PREDICTED:_thrombospondin_type-1_domain-containing_protein_4-like_isoform_X1_[Bombyx_mori]
Full name
ADAMTS-like protein 4      
Alternative Name
Thrombospondin repeat-containing protein 1
Location in the cell
Extracellular   Reliability : 3.74
 

Sequence

CDS
ATGGCGTCCGCATCCGTTCTACTTTATATCGTCTTGTTTTTCGTAATCGGACGGGAGTCTGTATTAGCAGGCAGCAATTCTCGGGAGCTGAGATGTGGAAGAAGGCTCGTTTCAGGATTGTTCTCGAAACCTCGACTGCCACTGGGCTACACTTTTGTAGCGACCGTCCCAAGGGGAGCATGCCGGATTAATGTGACAGAATTAGCTTCAAGCGAAAATTATATCGCCCTGAGGCTGTCGAATAGCTCGTATATATTAAATGGAGAGTTTGCCGTGAGTGCTCCAGGAATGTATGAGGCGGCTGGAGCCAGATTTCTTTATACCCGTACCGCTGGACTGGACAATGTGCATGCAAATGGACCCATATATCATCCTATTGATATTATGATTCTTTATACTCAACCAAAACCGAACATTAAATATGAATACTTTACGGACTCTCCGATTGATGAAGGTGATGAAGCTAGGCCAGAAATACCAGATGTCGTACCAGCTATTATTACTAAACATACAAGGAGACATCACAGTTTTGATGCTTATCCCAGGGCAACAGGGAATATACCTAGACATTTAGATCATCCGAGCACTTCCAATGAACAGACGAGTGTTGAAACTGGCATCGATGCAAATGTAATTGGCAACAGAAAATTCATGTGGAGAATTTTGTCATTCACCCAATGCACAAGAAGCTGTGGTGGCGGAATTCAGTTAGGAAAGTATAGGTGTGTAGAATCAACAAGCTCTGGAGATCGAGAGGTATCATCGGTCCATTGTACTGGTTCACCTCCGATCGGGCGGAGACGACGATGTGGTAATGTGCCCTGTCCACCAAGATGGAGGGCAGCCTCCTGGTCTCCTTGTCCCCGATGTGGACCTGCTACTCGGACAAGGATAGTAGGATGTGTACAGGATCACTCTAAAGGAATTACCAAGATAAGTGACCACAAATGTCCACCTCCAAAGCCACCCACAACAGAAATGTGTAACATCCCGAACTGCGATGACCTAAGTTTGGGCCCGGTAAGACGCATTGAATCAAAGAGAACTCGAAACAAGGAACTCACCGACACATTCCGCGAAGGCCCCGTTTATACCGTATCCATCAATACTACTGAATCCGAAATCGGCCCAGAATATAGTTTTAATGCGGCAGCTGGCTGGCTTTACACCGAATGGTCGGAGTGTATCGGGTGGTGTGTCGGTGGTGGCGTGCAAACAAGAGGTGTGCGTTGTACTGATCCTTCAGGATGTGCTCCAAGAAAGGAACCTCAAACAAGCAGAAGCTGCTCGCCTGCCCTGTCATGCGAGTCTTCGGAGGGGCAATGGTTTACTGGTGACTGGTCGCGTTGCACTTCAAAGTGCAAAGGACGACAGATTCGCGGTGTTCTGTGCATCGGTGGCACCGGTAGGCATCTTCGTGATTCGGCATGCAAGGACCCTAAGCCTGATCACGTAAGGGAATGCGGCGCCGACTGCCCTCCCACTTGGTACTTCAGCGATTGGGGCAAGTGCACAGGGAACTGTACATCTGAAGTAGGTTTACAAACGAGATCAGTAATCTGTGCTCACCCTGAAACCAACGGCACGGGCGGTGAAGCTGATTGCAAGACTGCGAGACCTCATGAGCAGAAATCTTGCGAAATGCGCTGTCCTACCATTTCTACTCTACCGCCAGATTTGACTATCGAATCTCAAAAAGTCGTTACTTCGAGTAATCGGCCTCCCATTATTAGAGAAACCGGACCTAGAGAATGCGAAGATAAACTGAACAACTGTTTCCTGGCGGTTCAAGCTCGCCTTTGTCATTATAACTTCTACGTGCAGAACTGCTGTAATTCCTGCAAAGGACTGTGA
Protein
MASASVLLYIVLFFVIGRESVLAGSNSRELRCGRRLVSGLFSKPRLPLGYTFVATVPRGACRINVTELASSENYIALRLSNSSYILNGEFAVSAPGMYEAAGARFLYTRTAGLDNVHANGPIYHPIDIMILYTQPKPNIKYEYFTDSPIDEGDEARPEIPDVVPAIITKHTRRHHSFDAYPRATGNIPRHLDHPSTSNEQTSVETGIDANVIGNRKFMWRILSFTQCTRSCGGGIQLGKYRCVESTSSGDREVSSVHCTGSPPIGRRRRCGNVPCPPRWRAASWSPCPRCGPATRTRIVGCVQDHSKGITKISDHKCPPPKPPTTEMCNIPNCDDLSLGPVRRIESKRTRNKELTDTFREGPVYTVSINTTESEIGPEYSFNAAAGWLYTEWSECIGWCVGGGVQTRGVRCTDPSGCAPRKEPQTSRSCSPALSCESSEGQWFTGDWSRCTSKCKGRQIRGVLCIGGTGRHLRDSACKDPKPDHVRECGADCPPTWYFSDWGKCTGNCTSEVGLQTRSVICAHPETNGTGGEADCKTARPHEQKSCEMRCPTISTLPPDLTIESQKVVTSSNRPPIIRETGPRECEDKLNNCFLAVQARLCHYNFYVQNCCNSCKGL

Summary

Description
Positive regulation of apoptosis. May facilitate FBN1 microfibril biogenesis (By similarity).
Subunit
Interacts with CTSB. Interacts with FBN1 (By similarity).
Keywords
Apoptosis   Complete proteome   Extracellular matrix   Glycoprotein   Reference proteome   Repeat   Secreted   Signal  
Feature
chain  ADAMTS-like protein 4
EMBL
BABH01017967    ODYU01006251    SOQ47921.1    NWSH01000085    PCG79780.1    KQ458575    + More
KPJ05721.1    AGBW02004790    OWR55369.1    KQ461073    KPJ09706.1    PCG79775.1    ODYU01003223    SOQ41695.1    KPJ05723.1    OWR55370.1    KPJ09707.1    JTDY01006868    KOB65631.1    BABH01017965    BABH01017966    JN701183    AEY78648.1    JTDY01004531    KOB68038.1    KZ288321    PBC28238.1    KQ414782    KOC61181.1    KK107139    EZA57658.1    QOIP01000003    RLU24431.1    GL888624    EGI58913.1    KQ983045    KYQ47910.1    GL451079    EFN80139.1    KQ434849    KZC08524.1    GEDC01021748    JAS15550.1    GL732525    EFX88574.1    GEZM01071486    JAV65765.1    UFQT01000002    SSX17113.1    KQ971354    KYB26305.1    KK852607    KDR20349.1    KQ414617    KOC68227.1    AMQN01004858    KB294550    ELU14368.1    CVRI01000038    CRK93983.1    ABLF02030672    ABLF02030674    SSX17112.1    AAAB01008980    EAA13911.4    GBYB01014270    GBYB01015211    JAG84037.1    JAG84978.1    KK107499    EZA49788.1    RLU24509.1    KQ981424    KYN41824.1    CH933807    KRG03706.1    KQ982482    KYQ55942.1    EDW13349.2    KQ978782    KYN28387.1    GL888575    EGI59403.1    ADTU01018081    ADTU01018082    ADTU01018083    ADTU01018084    KQ976666    KYM78288.1    KQ976818    KYN08109.1    GBRD01004470    GBRD01004469    GDHC01004985    JAG61351.1    JAQ13644.1    CH963857    EDW76039.2    GDHC01017670    JAQ00959.1    GL442166    EFN63877.1    CH916372    EDV98982.1    CH902620    KPU73913.1    RJVU01050255    ROL42153.1    KB200049    ESP03329.1    AMGL01004601    GCES01058343    JAR27980.1    ACTA01024204    CH954177    KQS70603.1    BC147928    AAI47929.1    AAEX03011048    JSUE03002373    LZPO01027203    OBS79198.1    JV636230    AFJ71570.1    BC099119    AAH99119.1    AQIA01002516    AQIA01002517    JH332400    EHH62692.1    CM001253    EHH15175.1    AY158701    BC117925    AAI17926.1    AAO17738.1    AEMK02000022    ADFV01183079   
Pfam
PF05986   ADAM_spacer1        + More
PF08686   PLAC
PF00090   TSP_1
Interpro
IPR010294   ADAM_spacer1        + More
IPR010909   PLAC       
IPR000884   TSP1_rpt       
IPR036383   TSP1_rpt_sf       
IPR013273   ADAMTS/ADAMTS-like       
IPR003582   ShKT_dom       
IPR011257   DNA_glycosylase       
IPR013087   Znf_C2H2_type       
IPR000048   IQ_motif_EF-hand-BS       
SUPFAM
SSF82895   SSF82895        + More
SSF48150   SSF48150       
Gene 3D
PDB
2RJQ     E-value=0.00385596,     Score=97

Ontologies

Topology

Subcellular location
   Colocalizes with FMN1 microfibrils in the eye ECM.   With evidence from 1 publications.
SignalP
Position:   1 - 23,         Likelihood:  0.887813
 
 
Length:
617
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
6.51195999999998
Exp number, first 60 AAs:
6.42169
Total prob of N-in:
0.31744
outside
1  -  617
 
 

Population Genetic Test Statistics

Pi
36.508784
Theta
150.459103
Tajima's D
-1.405474
CLR
1739.534352
CSRT
0.0747462626868657
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号