SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11470
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_4-like_isoform_X3_[Bombyx_mori]
Full name
PiggyBac transposable element-derived protein 4      
Location in the cell
Nuclear   Reliability : 3.383
 

Sequence

CDS
ATGGAAAGATTTAACCTTATTGCAATTGAGGATTTGCCCGCTGGGGAACCGATAGAGCAGGCATTGACGGAGCGAAGTAAGCGTTCATGGAACCCCCGAAATTATGAACCTGACGGAGAGGACATTCCAGTAATTTTGTCTTCACCTGCGATTCCGCCATCACCGGCAATGTACGTTGAATGTGGCGGCAGTGGTACGAGCACGCCATCTTCTAGATATAATATACAGATTTCTGTACATGGCAGCCGTAGTCCTTCGCCGTCACATAAACGTGTGCGTCGATCGCTTTGCCCAGACCAAGAACATGATATTACGAACAGAGATTCTATTTCATCGCTACGTCGACCGCTACGAGACTCTGAAATTTGCTACTTGTTGCACTATGGAAGTGACGACGATGACAGCGATGATGAGAGCCAGAATGATAACGACGAAATCGTTCCCATGATTATCCCCCGGGCAGCTGGAATACTGATGGACACTCCGGACGACGAGGAGATTGAGATTGACACGGCGGCGGCAACTAAACCTCTTGTGACATCTTCCTCGCCTTCCATCATTTCAGCACCTACATCACCAGCTCGTGATACCGGTATGAAGCCTAGTCATTTTTTTGAATTTGACTGGGGAACTTTCCCTGACTCTCCTATACCGCCAACAGAAAGGCGTGAATCTTTTAAGGAACACTCTGGTCCCACTGTCGCTGTAAGTGACCCTTACGAGATTTTTAGACTAATTTGGGACCAGGAGTTCATGGAATTTATTGTGCAGGAAACAAATAGATATGCCCAACAATTAGCTGCTGAAATGTTGGACGGCGGGGAATTACAGGCCTCCAGTAGGATTACAGAATGGAAAGAAACCAATGTAGACGAGTTATTGGTGTTCTTCGGAATATTACTGGCGATGGGAATCGTCATAAAGAACCGGGTTGAAGAGTACTGGAATACGGAACAAAACATCTTCTCCACTCCAGGTTTCAAAGTATATATGTCGCTTAGGAGGTTCCAGTTACTCAGCAGGTGCTTACATTTTAATAATTCCGAGAACTTGAGAAACCTCAACCTGGATCCCTCACAGGCAAAGCTTTTTAAAGTGGAGCCTGTGATTAGCCATTTGAATTCCAAGTTCACGGAATTATATATAATGAAGCAGAACATTGCTTTAGATGAATCGCTGCTGCAGTGGAAAGGTTGGTTGAACATCAACCAATTTATTCCAAACAAAGCTGCAGCAGTGGGCATAAAAACTTACGAAATATGTGAGTCGCAGACGGGGTATTTATGGCGATTTAAAATCCATGCCCATAAGGCTTCGCCTACAGTCTCAGAGGCTGATCCATTCACAGCGAGTACACCGGCGTTGGTTCTTAACCTTATCAAAGGTTTAGAACACAAAGGGTACACGTTGTGGATGGATAACTTCTACAATTCCCCAGCACTTGCCCGAAAACTCAAGTCGATTGGGTTTGATTGTGTCGGTACGTTGCGGACAAACCGCAAGTATGTCCCGACGGAACTGACCAATCTGAAAAAATCTCAGATGAAGCCCGGGCAAGTAGTAGGCTATACCAGTGGAGATGTCGATTGCATAATATGGAGAGATCAGAACCGCGTAGCGACGATCTCAACGTACCATGGCAATGCCGTCTCCACTAAAAACGGAGTAACAAAACTTATTTTGATACGTGACTACAACATCTGCATGGGTGGCGTGGATAAAAAAGATCAAATGTTGGCTGCATTCCCAATTGAACGCAAGAGGACACAAATTTGGTACAAGAAATTGTTTAAAAGGTTACTTAATGTTTCTGTGTTGAATGCCTATATCATACATAAACAGACCGCCACGGAGGTCTTGGACCACAGGGGCTTTAGAAAAAACCTGGTAGAATCCCTTTTGCGTAGGCATTCAATGAAAATGCAGCCATATGTCTTTTCTGCCAGGGTACAAGATACCATTTTCGAGGTGAGCCGCCATCACCCCGCCGAATATCCGCGGCTAACTTCATTAAACAGCACAAATCGCCATCGCCACCCATGTAAAGTGTGCGGCAAGCGCACGGTAACGTATTGCGTAGGTTGCGACAAACCTGTGTGCGTATTCACATGTTTTGTGAAACTTCACAATTAA
Protein
MERFNLIAIEDLPAGEPIEQALTERSKRSWNPRNYEPDGEDIPVILSSPAIPPSPAMYVECGGSGTSTPSSRYNIQISVHGSRSPSPSHKRVRRSLCPDQEHDITNRDSISSLRRPLRDSEICYLLHYGSDDDDSDDESQNDNDEIVPMIIPRAAGILMDTPDDEEIEIDTAAATKPLVTSSSPSIISAPTSPARDTGMKPSHFFEFDWGTFPDSPIPPTERRESFKEHSGPTVAVSDPYEIFRLIWDQEFMEFIVQETNRYAQQLAAEMLDGGELQASSRITEWKETNVDELLVFFGILLAMGIVIKNRVEEYWNTEQNIFSTPGFKVYMSLRRFQLLSRCLHFNNSENLRNLNLDPSQAKLFKVEPVISHLNSKFTELYIMKQNIALDESLLQWKGWLNINQFIPNKAAAVGIKTYEICESQTGYLWRFKIHAHKASPTVSEADPFTASTPALVLNLIKGLEHKGYTLWMDNFYNSPALARKLKSIGFDCVGTLRTNRKYVPTELTNLKKSQMKPGQVVGYTSGDVDCIIWRDQNRVATISTYHGNAVSTKNGVTKLILIRDYNICMGGVDKKDQMLAAFPIERKRTQIWYKKLFKRLLNVSVLNAYIIHKQTATEVLDHRGFRKNLVESLLRRHSMKMQPYVFSARVQDTIFEVSRHHPAEYPRLTSLNSTNRHRHPCKVCGKRTVTYCVGCDKPVCVFTCFVKLHN

Summary

Keywords
Complete proteome   Reference proteome  
Feature
chain  PiggyBac transposable element-derived protein 4
EMBL
KQ459989    KPJ18766.1    RSAL01001012    RVE40990.1    ODYU01000749    SOQ36006.1    + More
RSAL01000024    RVE52239.1    KZ150113    PZC73302.1    NWSH01000726    PCG74565.1    NEVH01017475    NEVH01002684    NEVH01001351    PNF24176.1    PNF41738.1    PNF42927.1    KZ150197    PZC72319.1    NEVH01026401    NEVH01025126    NEVH01020854    NEVH01013255    NEVH01000629    PNF14193.1    PNF16176.1    PNF21085.1    PNF29260.1    PNF43158.1    NEVH01009069    PNF34004.1    NWSH01005160    PCG64390.1    NEVH01026393    PNF14286.1    RSAL01000003    RVE54733.1    NWSH01000091    PCG79681.1    NWSH01008683    PCG62453.1    NEVH01011876    PNF31583.1    JU326601    AFE70357.1    CM001282    EHH62949.1    AHZZ02030739    CM001259    EHH27175.1    CABD030095328    AK057200    AK094816    AK289491    AC079203    AQIA01062119    JSUE03037923    AQIB01116437    ABGA01233763    NDHI03003689    PNJ08370.1    AACZ04060380    GABC01006592    GABD01003812    GABE01001690    NBAG03000487    JAA04746.1    JAA29288.1    JAA43049.1    PNI20010.1    RSAL01000097    RVE47692.1    GEGO01007089    JAR88315.1    ODYU01011285    SOQ56924.1    GEGO01006047    JAR89357.1    GECU01037003    GECU01013756    JAS70703.1    JAS93950.1    GDQN01004768    JAT86286.1    GEDC01003168    JAS34130.1    GEBQ01027849    JAT12128.1    BABH01028864    NEVH01018384    PNF23441.1    ABLF02006169    ABLF02055685    NEVH01015301    PNF27232.1    NEVH01026110    PNF14604.1    NEVH01026386    NEVH01013549    PNF14382.1    PNF28823.1    NEVH01010478    PNF32502.1    NEVH01000693    PNF43126.1    NEVH01020856    PNF21054.1    NEVH01024959    PNF16251.1    NEVH01024425    PNF17185.1    NEVH01005303    PNF38748.1   
Pfam
PF13843   DDE_Tnp_1_7        + More
PF13842   Tnp_zf-ribbon_2
Interpro
IPR029526   PGBD        + More
IPR032718   PGBD4_C_Znf-ribbon       
IPR018159   Spectrin/alpha-actinin       

Ontologies

Topology

Length:
710
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0450800000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00189
outside
1  -  710
 
 

Population Genetic Test Statistics

Pi
140.312189
Theta
160.291682
Tajima's D
-1.175948
CLR
107.569043
CSRT
0.108694565271736
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号