SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11440
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Full name
Guanylate cyclase      
Location in the cell
Nuclear   Reliability : 2.773
 

Sequence

CDS
ATGGCTACATCAGATCATAAGTTTGAATTAATGATGAAAGATCTTAAAAGAAAACGCGCATCTATTAAATGTCGTTTGACTAACTTTGGAAAATATGTGAATTCATTCGAAGGTGTAGAATTAACTGTTCATCAACGTACCGAGCTAAAACTGCGGATGGCAGGATCGCAAAGTTTAATGAATGATTTTAACCTCGTTCAGACACAAATAGAAGACATTAGTGTAGAAATCGACATAGAAAAACAGTTAGAATCGCGTGAAGATTTCGAGCAAAAATATTATAATATTCTTGCCCTTGCTGAATGTCTGACCACCGCTGATGAAAAGTCAAAAGACGAAGAAAAAGTACCGAAACAATGGTGTGCATCAGACATAATTTTACTCTTCAAGAAAGGATGTCCCTTAGATATAGGAAATTATAGACCCATAAGCCTGCTGGCGAGCATATATAAACTATTTTCATCCATAATTTTAAAGAGAATATCCGACGACATCGACAAGCTGCAACCAAAGGAGCAGGCGGGATTCAGATCAGGCTTTAGCACAATGGACCACATACAAACACTAGAGCAGGTCATAGAAAAATACAGAGAATATAAAAGACCTCTGTATGTGGCCTTCATTGACTACAGTAAAGCTTTCGACAGCATCAGTCACTGTTCAATCTGGAACGCATTACAACAATCAAATGTTAACTATAAATACATCAATATCTTGAAATATATCTACACAAAAAGTACGAGCAGAGTTAAATTAGAAACTAGAGGAGACGAGATAAAAATAGAACGAGGAGTCAGACAGGGAGATCCTCTTTCCCCGAAGCTGTTCATAGCAGTACTTGAAACTATTTTTCAAAAACTAGATTGGAAAAAAAGGGGAGTGTACATAAACGGACACTACCTAAACCATCTGAGGTTCGCTGACGATGTTGTTATAATTGCTGAAACTGCCAAAGACCTAGAGGAAATGATGAGATCACTGGACTGCGAAAGTTCAAAAATCGGCCTAGAAATGAATGTAAGCAAAACTAAGATATTAACCAACAATCACGAACGCCCGATAATGATAAAAGGTAACAATATAGAATACGTCAGCGAATACATCTACTTAGGGAAGCAAATCTCATTCAAAACGACAAGCAACGAAGAAGAAGTAACAAGAAGAATCAACGCAACTTGGAAGAAATTCTGGGCACTAAAAGAAATCCTAAAAGGGAACTACAGCTTGCGTATGAAAAGGGCAACATTTGATACATGCCTGTTACCCTGCTTGTTGTATGGCTGCCAAACGTGGATATTTACAAATAAAATAAAACAAAAAATTAAATGCAGTCAAACAGCCATGGAAAGGAGCATGTTGAAAATTAGAAGAATACATAGAATTAAGAATGAAAGCATTCGTCAAAAAACTAAACTTACCGATGCTCTCAGCCACGCACTCTCACTTAAGTGGAGATGGGCCGGACACATCTCACGATACCCAGACAAAAGATGGACCATTGAAGCCACACGATGGAAAGGACCAATGGGGAAAAGGAATGTTGGTCGACAATTAAGACGATGGGCCGATGACATAACACACGTCGCAGGAAACGACTGGATAAAATCAGGCAAGGACAAGGAGTCATGGAAAAGGATGGAGGAGGCCTTTACCCAGATAGGGGTCCAAATCTCATAA
Protein
MATSDHKFELMMKDLKRKRASIKCRLTNFGKYVNSFEGVELTVHQRTELKLRMAGSQSLMNDFNLVQTQIEDISVEIDIEKQLESREDFEQKYYNILALAECLTTADEKSKDEEKVPKQWCASDIILLFKKGCPLDIGNYRPISLLASIYKLFSSIILKRISDDIDKLQPKEQAGFRSGFSTMDHIQTLEQVIEKYREYKRPLYVAFIDYSKAFDSISHCSIWNALQQSNVNYKYINILKYIYTKSTSRVKLETRGDEIKIERGVRQGDPLSPKLFIAVLETIFQKLDWKKRGVYINGHYLNHLRFADDVVIIAETAKDLEEMMRSLDCESSKIGLEMNVSKTKILTNNHERPIMIKGNNIEYVSEYIYLGKQISFKTTSNEEEVTRRINATWKKFWALKEILKGNYSLRMKRATFDTCLLPCLLYGCQTWIFTNKIKQKIKCSQTAMERSMLKIRRIHRIKNESIRQKTKLTDALSHALSLKWRWAGHISRYPDKRWTIEATRWKGPMGKRNVGRQLRRWADDITHVAGNDWIKSGKDKESWKRMEEAFTQIGVQIS

Summary

Catalytic Activity
GTP = 3',5'-cyclic GMP + diphosphate
EC Number
4.6.1.2
EMBL
KZ150317    PZC71439.1    FJ265562    ADI61830.1    FJ265563    ADI61831.1    + More
ODYU01008249    SOQ51673.1    KZ150485    PZC70710.1    KZ150108    PZC73382.1    FJ265564    ADI61832.1    ODYU01004982    SOQ45402.1    RSAL01002362    RVE40503.1    GBBI01004876    JAC13836.1    FJ265561    ADI61829.1    FJ265549    ADI61817.1    FJ265542    ADI61810.1    EF113398    EF113401    ABO45231.1    EF113402    ABO45239.1    FJ265551    ADI61819.1    FJ265550    ADI61818.1    MRZV01002136    PIK34564.1    KZ149907    PZC78256.1    GBGD01000380    JAC88509.1    ODYU01004088    SOQ43598.1    MRZV01000899    PIK42833.1    AAGJ04144474    KZ149985    PZC75698.1    FJ265545    ADI61813.1    JARK01001370    EYC16151.1    KZ150072    PZC74016.1    JARK01001677    EYB83168.1    FJ265543    ADI61811.1    FJ265544    ADI61812.1    JARK01001340    EYC31295.1    EYB83167.1    JARK01001351    EYC23395.1    JARK01001655    EYB84321.1    RSAL01002130    RVE40575.1    JARK01001362    EYC18844.1    EYC18843.1    JARK01000173    EYC41342.1    JARK01000388    EYC37469.1    EYC16150.1    UZAG01000503    VDO08661.1    AAGJ04050748    GFAC01005640    JAT93548.1    JARK01001568    EYB89432.1    JARK01001364    EYC18031.1    JARK01001500    JARK01001343    EYB95040.1    EYC28825.1    JARK01001423    EYC04578.1    JARK01001361    EYC19034.1    JARK01001349    EYC24735.1    JARK01001344    EYC28218.1    JARK01001438    EYC02012.1    JARK01001346    EYC26784.1    JARK01001517    EYB93530.1    JARK01001341    EYC29807.1    JARK01001736    JARK01001462    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    EYC31302.1    JARK01001434    EYC02684.1    EYC28635.1    JARK01001378    EYC13977.1    EYC30223.1    JARK01001406    EYC07496.1    JARK01001376    EYC14422.1    JARK01001639    EYB85201.1    JARK01001389    EYC11015.1    JARK01001424    EYC04315.1    EYC04314.1    EYC04317.1    EYC04316.1    JARK01000302    EYC38674.1    CAVP010058300    CDL94394.1    JARK01001473    EYB97806.1    JARK01001630    EYB85641.1    JARK01000077    EYC43894.1    JARK01001380    EYC13322.1    JARK01001470    JARK01000204    EYB98082.1    EYC40602.1    JARK01001475    EYB97550.1    JARK01001502    EYB94855.1    EYB98081.1    EYC40601.1    JARK01001365    EYC18010.1    JARK01000248    EYC39628.1    EYC18009.1    EYC33297.1    EYC10874.1    JARK01000083    EYC43695.1    JARK01001432    EYC03125.1    JARK01001497    EYB95322.1    JARK01000347    EYC38051.1    EYC28216.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001467    JARK01001463    JARK01001457    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001353    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1    EYC26445.1    JARK01000063    EYC44387.1    JARK01001421    EYC04912.1    JARK01001348    EYC25048.1    JARK01000256    EYC39462.1    EYC25050.1    JARK01001581    EYB88505.1    JARK01001372    EYC15614.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF01826   TIL
PF01094   ANF_receptor
PF07714   Pkinase_Tyr
PF00211   Guanylate_cyc
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036084   Ser_inhib-like_sf       
IPR002919   TIL_dom       
IPR001828   ANF_lig-bd_rcpt       
IPR001245   Ser-Thr/Tyr_kinase_cat_dom       
IPR011009   Kinase-like_dom_sf       
IPR001170   ANPR/GUC       
IPR001054   A/G_cyclase       
IPR028082   Peripla_BP_I       
IPR000719   Prot_kinase_dom       
IPR029787   Nucleotide_cyclase       
IPR029052   Metallo-depent_PP-like       
SUPFAM
SSF56219   SSF56219        + More
SSF57567   SSF57567       
SSF53822   SSF53822       
SSF55073   SSF55073       
SSF56112   SSF56112       
Gene 3D
PDB
6AR3     E-value=0.00285995,     Score=98

Ontologies

Topology

Length:
558
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.53579
Exp number, first 60 AAs:
0.0079
Total prob of N-in:
0.00183
outside
1  -  558
 
 

Population Genetic Test Statistics

Pi
218.328364
Theta
197.060936
Tajima's D
2.775008
CLR
136.050559
CSRT
0.966501674916254
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号