SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11421
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.736
 

Sequence

CDS
ATGTGTGGAGTAACGAGAATGGATAGAATACGGAATGAATATGTTGGAGGAAGTCTGAAAGTGGCACCTGTGACAGAGAAGCTGAGAAGTGCACGTTTGGGATGGTATGGACATGTGATGAGACGAAATGAAAATGAGGCTGAGACATGGGTACTCAGCAAAAAAGATGAGAACCGTCTACTTGTGTTCGAGCGTAAGATTCTAAGACGGATATTCGGTGCTGTGCGGGAAAACCAGATATGGAGGACGCGCTATAACCACGAGTTGTATGATGTTTACAAAGATCCTAACATCATAACAACTATAAAGATTGAACGCCTACGATGGGCAGGACATGTGGTTCGAATGGAGAGTACCAGAATGCCAAGACAATTGCTCTATGGCAAACCAGAGGGCCGCAGAAGTCGTGGCAGACCCAAACTTCGATGGTTTGATGGCGTGGAGCGCGACCTCAAAAATATCGGCGTCAAGAACTGGAAGGAGAAAGCCCTGAACAGAGCAGTCTGGAGAGACATACTGGACCAGGCTAAGGCCCACCCTGGGCTGTAA
Protein
MCGVTRMDRIRNEYVGGSLKVAPVTEKLRSARLGWYGHVMRRNENEAETWVLSKKDENRLLVFERKILRRIFGAVRENQIWRTRYNHELYDVYKDPNIITTIKIERLRWAGHVVRMESTRMPRQLLYGKPEGRRSRGRPKLRWFDGVERDLKNIGVKNWKEKALNRAVWRDILDQAKAHPGL

Summary

EMBL
FJ265555    ADI61823.1    PYGN01000613    PSN43351.1    PYGN01000119    PSN53667.1    + More
PYGN01000168    PSN52268.1    PYGN01000612    PSN43376.1    PYGN01001144    PSN37211.1    PYGN01000540    PSN44578.1    NEVH01026393    PNF14276.1    PYGN01000010    PSN58017.1    PYGN01001312    PSN35775.1    NEVH01010582    PNF32229.1    NEVH01001338    PNF43056.1    GBHO01016952    JAG26652.1    GBBI01004263    JAC14449.1    AJVK01015081    GBBI01004261    JAC14451.1    PYGN01001438    PSN34841.1    NEVH01016288    PNF26362.1    PYGN01000136    PSN53183.1    GBRD01000202    JAG65619.1    PYGN01000629    PSN43121.1    GDAI01000742    JAI16861.1    NEVH01012097    PNF30338.1    PSN53184.1    GECU01033590    JAS74116.1    PYGN01000287    PSN49259.1    PYGN01000372    PSN47498.1    PYGN01000313    PSN48686.1    GGFM01007299    MBW28050.1    PYGN01000015    PSN57778.1    PYGN01003402    PSN29545.1    GECU01035086    JAS72620.1    GDHC01021627    JAP97001.1    NEVH01024421    PNF17395.1    GGFJ01005240    MBW54381.1    PYGN01000682    PSN42293.1    GGFL01003846    MBW68024.1    PYGN01006068    PSN29155.1    GGFL01003845    MBW68023.1    PYGN01000535    PSN44652.1    LBMM01005351    KMQ91586.1    GGFK01003183    MBW36504.1    PYGN01000294    PSN49097.1    GGFK01002192    MBW35513.1    GGFK01002196    MBW35517.1    QOUI01000020    RCK67885.1    GGFK01003613    MBW36934.1    GECZ01019223    JAS50546.1    GGFK01005184    MBW38505.1    GALX01003282    JAB65184.1    GGFK01001798    MBW35119.1    GGFK01001949    MBW35270.1    PYGN01000254    PSN50032.1    IAAA01009800    IAAA01009801    LAA04372.1    IAAA01009799    LAA04366.1    PYGN01000325    PSN48468.1    GBRD01011073    JAG54751.1    GBBI01004262    JAC14450.1    PYGN01000106    PSN54154.1    PYGN01001294    PSN35934.1    HACL01000314    CFW94608.1    RAPH01000014    RNL66055.1    KK852643    KDR19558.1    PYGN01000575    PSN43995.1    PYGN01000436    PSN46412.1    PYGN01001045    PSN38155.1    NEVH01000618    PNF43171.1    GBBI01004199    JAC14513.1    GL439190    EFN67634.1    GL440612    EFN65619.1    PYGN01000266    PSN49694.1    PSN44642.1    GAPW01000199    JAC13399.1    PYGN01000191    PSN51624.1    PYGN01000092    PSN54488.1    GAKP01022638    GAKP01022636    GAKP01022635    JAC36314.1    GBHO01044844    JAF98759.1    GBHO01045275    JAF98328.1    NEVH01011195    PNF31853.1    PYGN01001951    PSN32040.1    GGMS01002456    MBY71659.1    HACL01000173    CFW94467.1    PYGN01000451    PSN46127.1    AJVK01002125   
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF14529   Exo_endo_phos_2
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
182
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.29283
outside
1  -  182
 
 

Population Genetic Test Statistics

Pi
328.239693
Theta
198.854413
Tajima's D
1.965992
CLR
0
CSRT
0.879106044697765
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号