SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11420
Annotation
transposase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.408
 

Sequence

CDS
ATGTCGCGTATTTTAAAAGATGACTTAGGACTTGCAGCCTATAAGAGACGTACTGGTCATTTCTTAACTGATAATTTAAAAGAGAATAGGGTGGTAAAATCGAAGGAACTACTGAATCGGTACACAGAGGGAGGTCATAGAAAAAAATTGTTTACGGATGAGAAATTTTTTACAATTGAGCAACATTTTAACAAACAACATGACCGTATTTATGCTCAAAGCTCTAAGGAAGCTTCCCAATTAGTCGACAGAGTGCAACGTGGGCACTATCCGACTTCAGTGATGGTTTGGTGGGGTATTAGCTATGAAGGAGTGACTGAGCCATACTTTTGTGAAAAAGGTATCAAAACATTGGCACAAGTGTATCAAGATACCATTCTTGAGAAGGTAGCGAAGCCCCATAACAACATCATGTTCAATAATCAAGAATGGTCCTTCCAGCAAGACTCGGCGCCAGGTCATAAAGCTCGGTCTACGCAGTCTTGGTTGGAAACGAACGTTTCGGACTTCATCAGAGCTGAAGACTGGCCGTCGTCTAGTCCCGATCTTAATCCGCTGGATTTTGATTTATGGTCAGTTTTAGAGAGTACGGCTTGCTCTAAACGCCATGATAATTTGGAGTCCATAAAACAATCTGTACGATTGGCAGTGAAAAATTTTCCCGTGGAAAGAGTGCGTGCTTTTATTGATAACTGGCCTCAACGTTTAAAGGACTGTATTGCAGCCAATGGAGACCACTTCGAATAA
Protein
MSRILKDDLGLAAYKRRTGHFLTDNLKENRVVKSKELLNRYTEGGHRKKLFTDEKFFTIEQHFNKQHDRIYAQSSKEASQLVDRVQRGHYPTSVMVWWGISYEGVTEPYFCEKGIKTLAQVYQDTILEKVAKPHNNIMFNNQEWSFQQDSAPGHKARSTQSWLETNVSDFIRAEDWPSSSPDLNPLDFDLWSVLESTACSKRHDNLESIKQSVRLAVKNFPVERVRAFIDNWPQRLKDCIAANGDHFE

Summary

Similarity
Belongs to the TGF-beta family.
EMBL
U47917    AAB47739.1    JF779677    AEO90418.1    AF461149    AAN06610.1    + More
AB363006    AB363010    AB363014    BAG15923.1    BAG15924.1    AB473770    BAH20555.1    AB363018    BAG15926.1    AB363028    BAG15927.1    ODYU01006378    SOQ48174.1    LNIX01000030    OXA41211.1    RSAL01000012    RVE53510.1    RSAL01000021    RVE52408.1    JOJR01000015    RCN51257.1    UYSL01019905    VDL71189.1    JOJR01000583    RCN36166.1    JARK01000255    EYC39473.1    JARK01001411    EYC06502.1    JARK01001601    EYB87313.1    RSAL01000063    RVE49524.1    CAVP010059404    CDL95787.1    KQ459680    KPJ20472.1    KA646003    AFP60632.1    PDUG01000005    PIC23776.1    DS268508    EFO83264.1    DS268428    EFO94379.1    DS268679    EFO98285.1    PDUG01000012    PIC13506.1    DS268673    EFO98001.1    DS268421    EFO88618.1    DS268466    EFP06959.1    JARK01001337    EYC34439.1    DS268612    EFO94085.1    DS268525    EFO85497.1    DS268492    EFP11689.1    KX931010    APL98300.1    DS268539    EFO88027.1    LFYR01002220    KMZ56176.1    JARK01001345    EYC27589.1    PIC28734.1    PIC29926.1    PDUG01000006    PIC20538.1    DS268747    EFP00909.1    HE601413    CAS00486.1    PDUG01000001    PIC51673.1    DS268565    EFO90304.1    UYSL01019770    VDL69590.1    JARK01000176    EYC41234.1    JARK01000059    EYC44525.1    JARK01001658    EYB84158.1    UZAH01001595    VDO19836.1    DS268606    EFO93488.1    DS268545    EFO88382.1    PIC53815.1    UZAH01029309    VDP05368.1    KN726990    KIH66733.1    JARK01001418    EYC05389.1    UYSL01020440    VDL74616.1    PDUG01000004    PIC32571.1    HE601187    CAR99265.1    JARK01001499    EYB95145.1    UZAH01027257    VDO90094.1    JARK01000073    EYC44053.1    HE601047    HE600964    CAS00660.1    CAS01013.1    HE601507    CAR99239.1    HE600908    CAR99632.1    HE601437    CAR99651.1    EFP11674.1    KN728607    KIH63514.1    RSAL01000110    RVE47159.1    PIC32570.1    JARK01001421    EYC04911.1    PIC24955.1   
Pfam
PF00019   TGF_beta        + More
PF13358   DDE_3
PF00292   PAX
PF00083   Sugar_tr
PF00250   Forkhead
PF13936   HTH_38
Interpro
IPR009057   Homeobox-like_sf        + More
IPR001839   TGF-b_C       
IPR029034   Cystine-knot_cytokine       
IPR017948   TGFb_CS       
IPR015615   TGF-beta-rel       
IPR036388   WH-like_DNA-bd_sf       
IPR038717   Tc1-like_DDE_dom       
IPR001523   Paired_dom       
IPR036906   ATPase_V1_fsu_sf       
IPR036259   MFS_trans_sf       
IPR020846   MFS_dom       
IPR005828   MFS_sugar_transport-like       
IPR036390   WH_DNA-bd_sf       
IPR001766   Fork_head_dom       
IPR030456   TF_fork_head_CS_2       
IPR025246   IS30-like_HTH       
SUPFAM
SSF46689   SSF46689        + More
SSF57501   SSF57501       
SSF103473   SSF103473       
SSF46785   SSF46785       
Gene 3D
PDB
5CR4     E-value=5.56806e-08,     Score=134

Ontologies

Topology

Subcellular location
Secreted  
Nucleus  
Length:
248
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00204
Exp number, first 60 AAs:
0
Total prob of N-in:
0.03208
outside
1  -  248
 
 

Population Genetic Test Statistics

Pi
37.62215
Theta
50.988472
Tajima's D
-0.593421
CLR
0.000166
CSRT
0.220838958052097
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号