SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11370  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA001859
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_dynein_heavy_chain_10?_axonemal-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 2.77
 

Sequence

CDS
ATGCAGCTCGGAGGAGCTCCAGCCGGTCCCGCTGGTACCGGCAAAACCGAAACTACAAAAGATTTAGCAAAGGCTTTAGGTCTTCTATGCGTGGTGACCAACTGCGGGGAGGGAATGGATTTCCGAGCTGTTGGACAGATCCTCGCTGGCCTTTGCCAGTGCGGTGCTTGGGGATGCTTCGACGAATTCAACAGGATTGATATATCAGTGCTGTCAGTTATTTCAACGCAGCTACAGTGCATCAGAAGTGCTTTGCTCATGAAATTGAAACGTTTCACGTTTGAAGGGCAGGAGATAGCAATGGATAGCAAAGTTGGTATCTTTATCACCATGAATCCTGGATACGCCGGTCGAACGGAGTTACCTGAATCCGTGAAAGCTTTGTTCAGACCTGTCGTGTGTATTCTACCTGACCTTGAAATGATTTGTCAGATATCCCTATTCTCTGATGGATTTCTTACGGCCAAAGTTCTAGCCAAGAAAATGACAGTCCTATACAAAGTAGCAAGAGAACAACTATCAAAACAATCTCACTATGACTGGGGATTAAGGGCTCTAACGGCGGTCCTCAGGATGGCGGGGAAATTGAGAAGAGATTCCCCAGGACTCAGTGAAATTATGGTGCTGATGAGAGCTTTAAGGGACATGAACCATCCAAAATTCGTATTTGAAGACGTGCCTCTATTTCTTGGACTGATAAAAGACCTTTTCCCTGGGTTGGAGTGTCCTCGTGTTGGTTATCCAGAATTCAATGCTGCCGTTCTTGAGGTTTTAGAAAAAGATGGATATGTTGTACTACCGCATCAGGTTGATAAAGTGGTTCAACTTTACGAAACGATGATGACTAGACACTGTACGATGCTAGTGGGGCCCACGGGCGGCGGCAAGACGGTTATACTTCATTGTCTAGTGAAAGCTCAAACTAATTTAGGTCTACCTACAAAACTTACAGTTGTTAATCCAAAGGCCTGCTCCGTTATAGAGCTGTATGGTATCTTGGACCCTGTAACAAGAGACTGGACCGATGGTTTATATTCAAAAATATTTAGGGAAATGAACAGACCGGCAGAAAAGAATGAGCGTCGCTACTCATTATTCGATGGAGATGTAGACGCTCTTTGGATAGAGAACATGAATTCGGTAATGGACGATAACAAGCTCTTGACCCTCGCGAACGGAGAGCGAATCAGACTGGCCCCGTACTGCTCTTTACTCTTCGAAGTTGGAGATTTGAACTATGCCTCTCCGGCCACTGTTTCCAGAGCCGGAATGGTGTTCGTCGACCCTAAGAACTTGGGATACGAACCTTACTGGGAAAGGCACTTGTAA
Protein
MQLGGAPAGPAGTGKTETTKDLAKALGLLCVVTNCGEGMDFRAVGQILAGLCQCGAWGCFDEFNRIDISVLSVISTQLQCIRSALLMKLKRFTFEGQEIAMDSKVGIFITMNPGYAGRTELPESVKALFRPVVCILPDLEMICQISLFSDGFLTAKVLAKKMTVLYKVAREQLSKQSHYDWGLRALTAVLRMAGKLRRDSPGLSEIMVLMRALRDMNHPKFVFEDVPLFLGLIKDLFPGLECPRVGYPEFNAAVLEVLEKDGYVVLPHQVDKVVQLYETMMTRHCTMLVGPTGGGKTVILHCLVKAQTNLGLPTKLTVVNPKACSVIELYGILDPVTRDWTDGLYSKIFREMNRPAEKNERRYSLFDGDVDALWIENMNSVMDDNKLLTLANGERIRLAPYCSLLFEVGDLNYASPATVSRAGMVFVDPKNLGYEPYWERHL

Summary

EMBL
BABH01018149    BABH01018150    BABH01018151    BABH01018152    BABH01018153    BABH01018154    + More
BABH01018155    BABH01018156    BABH01018157    BABH01018158    NWSH01003463    PCG66238.1    AGBW02014810    OWR41026.1    KQ460436    KPJ14720.1    KQ459053    KPJ04007.1    ODYU01003927    SOQ43291.1    KZ150261    PZC71734.1    RSAL01000096    RVE47735.1    KB631802    ERL86248.1    APGK01057806    KB741282    ENN70796.1    KQ971352    EFA06783.2    DS235430    EEB15698.1    CH940656    EDW58669.2    AE014297    ACZ95053.1    AAF56793.3    CH480837    EDW49128.1    OUUW01000005    SPP80284.1    CM000160    EDW98410.2    CH964232    EDW81485.2    CH916369    EDV92648.1    AGB96416.1    JXJN01025625    JXJN01025626    JXJN01025627    CP012526    ALC46147.1    AAAB01008987    EAA01367.6    CH479179    EDW24982.1    CH933806    EDW15281.2    CM000070    EIM52552.2    GEDC01002595    JAS34703.1    KRG01490.1    CH902617    EDV43610.2    CCAG010022515    GEDC01014670    JAS22628.1    GECZ01015781    JAS53988.1    EAL27566.4    EIM52553.2    AXCN02000261    QRBI01000121    RMC05733.1    AADN05000505    DS231835    EDS32907.1    LSYS01006629    OPJ75091.1    ATLV01022433    ATLV01022434    KE525332    KFB47668.1    AMQN01006005    KB297391    ELU10552.1    QUSF01000066    RLV96891.1    AKHW03002185    KYO39614.1    BX323557    MUZQ01000225    OWK54873.1    AAMC01042923    AAMC01042924    NIVC01000119    PAA90251.1    AERX01026833    AERX01026834    KL447264    KFO71450.1    KB742840    EOB03708.1    ADON01049977    ADON01049978    ADON01049979    AGTO01010316    AKCR02000030    PKK25878.1    AYCK01007726    KV926115    PIO37502.1    JH817887    EKC41048.1    KK734463    KFR08294.1    CVRI01000070    CRL07346.1    U03973    AAA63587.1    KL336764    KFZ50352.1    AEMK02000096    UFQS01000469    UFQT01000469    SSX04260.1    SSX24625.1    AHAT01005142    AHAT01005143    KZ288193    PBC34042.1    GG666468    EEN67956.1   
Pfam
PF12781   AAA_9        + More
PF12774   AAA_6
PF08393   DHC_N2
PF08385   DHC_N1
PF17857   AAA_lid_1
PF12777   MT
PF18199   Dynein_C
PF17852   Dynein_AAA_lid
PF18198   AAA_lid_11
PF12780   AAA_8
PF03028   Dynein_heavy
PF00781   DAGK_cat
PF00241   Cofilin_ADF
Interpro
IPR042222   Dynein_2_N        + More
IPR041589   DNAH3_AAA_lid_1       
IPR035706   AAA_9       
IPR024317   Dynein_heavy_chain_D4_dom       
IPR024743   Dynein_HC_stalk       
IPR027417   P-loop_NTPase       
IPR041466   Dynein_AAA5_ext       
IPR003593   AAA+_ATPase       
IPR013594   Dynein_heavy_dom-1       
IPR042219   AAA_lid_11_sf       
IPR013602   Dynein_heavy_dom-2       
IPR004273   Dynein_heavy_D6_P-loop       
IPR035699   AAA_6       
IPR041228   Dynein_C       
IPR042228   Dynein_2_C       
IPR041658   AAA_lid_11       
IPR026983   DHC_fam       
IPR002108   ADF-H       
IPR017904   ADF/Cofilin       
IPR017438   ATP-NAD_kinase_N       
IPR016064   NAD/diacylglycerol_kinase_sf       
IPR001206   Diacylglycerol_kinase_cat_dom       
IPR029006   ADF-H/Gelsolin-like_dom_sf       
SUPFAM
SSF52540   SSF52540        + More
SSF111331   SSF111331       
PDB
4RH7     E-value=3.73151e-100,     Score=932

Ontologies

Topology

Length:
442
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01154
Exp number, first 60 AAs:
0.00348
Total prob of N-in:
0.00078
outside
1  -  442
 
 

Population Genetic Test Statistics

Pi
273.316617
Theta
171.259321
Tajima's D
1.586384
CLR
0.644548
CSRT
0.805109744512774
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号