SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11355
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
ATP-dependent DNA helicase      
Location in the cell
Cytoplasmic   Reliability : 1.063 Extracellular   Reliability : 1.223 Nuclear   Reliability : 1.288
 

Sequence

CDS
ATGGTGGTTATCTCTGGTCTGCCCTACGTGGATTGCTTTATTAACGCAGAATACACCGATCCTCCCTGGGACCTAGAAGCGGAGGCGCTCGCTGCGGATTACGCGTGGCGATGCGATCTCCGCTCCAGGGGGGAGCCGCGTCCCGGCGCGGCGGAAGTTCGAGCGCGGAAACTTCAATCTCGGCGTGCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCGGACCCCGCCTACGGGCGACGGACTGTCGAGGCGATCCGCCCGGTCCTCTCGGACTGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGAGCGACGCAGGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCCGGAGGGAGCCGACGCCGAAGTGCCACCACTGCAGTGGCTGCAACGAGGACACGGCGGAGCACACGCTCGCGTACTGCACCGCTTTCGCGGAGCAGCGCCGCGTCCTCGTTACAAAAATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTACGATGCTCGGCAGCGACGAGTCCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAACGGGAGAGGGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCGTCGAGCCGGGGTTCGGAGGAGGGCGTTTGTCCAGCTCCAGCCCCTATGA
Protein
MVVISGLPYVDCFINAEYTDPPWDLEAEALAADYAWRCDLRSRGEPRPGAAEVRARKLQSRRAVLEAWSRRLADPAYGRRTVEAIRPVLSDWVNRDRGRLTFRATQVLTGHGCFGRYLHLVARREPTPKCHHCSGCNEDTAEHTLAYCTAFAEQRRVLVTKIGPDLSLPTVVATMLGSDESWQAMLDFCESTISQKEAAERERESSSSLSAPCRRRRAGVRRRAFVQLQPL

Summary

Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Cofactor
Mg(2+)
Similarity
Belongs to the helicase family.
EC Number
3.6.4.12
Pfam
PF05970   PIF1        + More
PF00059   Lectin_C
PF00078   RVT_1
PF14529   Exo_endo_phos_2
Interpro
IPR016187   CTDL_fold        + More
IPR010285   DNA_helicase_pif1-like       
IPR016186   C-type_lectin-like/link_sf       
IPR001304   C-type_lectin-like       
IPR018378   C-type_lectin_CS       
IPR027417   P-loop_NTPase       
IPR000477   RT_dom       
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF52540   SSF52540        + More
SSF56436   SSF56436       
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
231
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00672
Exp number, first 60 AAs:
0.00018
Total prob of N-in:
0.01484
outside
1  -  231
 
 

Population Genetic Test Statistics

Pi
30.74189
Theta
27.199519
Tajima's D
0.616928
CLR
9.251034
CSRT
0.546322683865807
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号