SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11329
Annotation
transposase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.975
 

Sequence

CDS
ATGGTTTGGTGGGGTATTAGCTATGAAGGAGTGACTGAGCCATACTTTTGTGAAAAAGGTATCAAAACATTGGCACAAGTTTATCAAGATACCATTCTTGAGAAGGTAGTGAAGCCCATTAATAACACTATGTTCAATAATCAAGAATGGTCCTTCCAGCAAGACTCGGAGCCAGGTCATAAAGCTCAGTCTACGCAGTCTTGGTTGGAAATGAACGTTTCGGACTTCATCAGAGCTGAAGACTGGCCGTCGTCTAGACCCGATCTTAATCCGCTGGATTATGATTTATGGTCAGTTTTAGAGAGTACGGCTTGCTCTAAACGCCATGATAATTTGGAGTCCCTAAAACAATCCGTAGGATTGGCAGTGCAAAATGTTCCCATGGAAAGAGTGCGTGCTTCTATTGATAACTGGCCTCAACGTTTAAAGGACTGTATTGCAGCCAATGGAGACTACTTCGAATAA
Protein
MVWWGISYEGVTEPYFCEKGIKTLAQVYQDTILEKVVKPINNTMFNNQEWSFQQDSEPGHKAQSTQSWLEMNVSDFIRAEDWPSSRPDLNPLDYDLWSVLESTACSKRHDNLESLKQSVGLAVQNVPMERVRASIDNWPQRLKDCIAANGDYFE

Summary

Similarity
Belongs to the TGF-beta family.
EMBL
U47917    AAB47739.1    JF779677    AEO90418.1    AF461149    AAN06610.1    + More
AB363006    AB363010    AB363014    BAG15923.1    BAG15924.1    AB473770    BAH20555.1    AB363028    BAG15927.1    AB363018    BAG15926.1    RSAL01000012    RVE53510.1    LNIX01000030    OXA41211.1    RSAL01000114    RVE46946.1    ODYU01006378    SOQ48174.1    RSAL01000174    RVE45058.1    KN728435    KIH63782.1    UYSL01019905    VDL71189.1    JARK01001411    EYC06502.1    JOJR01000583    RCN36166.1    JOJR01000015    RCN51257.1    UZAH01000669    VDO19161.1    UZAH01026445    VDO80847.1    CH902625    KPU75512.1    JARK01001601    EYB87313.1    CAVP010058332    CDL94449.1    JARK01001337    EYC34439.1    KA646003    AFP60632.1    RSAL01000021    RVE52408.1    KX931010    APL98300.1    UZAH01001595    VDO19836.1    UZAH01031030    VDP13493.1    PDUG01000012    PIC13506.1    JARK01001345    EYC27589.1    CAVP010059404    CDL95787.1    JARK01000059    EYC44525.1    KN769991    KIH46151.1    UYSL01022144    VDL79905.1    HE601413    CAS00486.1    UYSL01009772    VDL68385.1    UZAH01025744    VDO69727.1    JARK01000176    EYC41234.1    JARK01001658    EYB84158.1    KN728607    KIH63514.1    JARK01001418    EYC05389.1    JARK01001471    EYB97976.1    UYSL01021399    VDL78127.1    PDUG01000005    PIC28734.1    DS268433    EFO97645.1    PDUG01000006    PIC20538.1    DS268492    EFP11674.1    UYSL01002425    VDL65835.1    DS268612    EFO94085.1    KI662043    ETN73029.1    DS268747    EFP00909.1    DS268606    EFO93488.1    DS268428    EFO94379.1    PIC29926.1    DS268508    EFO83264.1    DS268420    EFO87874.1    CH902666    KPU74611.1    DS268679    EFO98285.1    PDUG01000001    PIC51673.1    JARK01000255    EYC39473.1    DS268466    EFP06959.1    PIC31069.1    DS268421    EFO88618.1    CAVP010058755    CDL95145.1    RSAL01000209    RVE44259.1    DS268673    EFO98001.1    EFP11689.1    JARK01001350    EYC23962.1    RSAL01000004    RVE54604.1    UYSL01020634    VDL75527.1    PIC23776.1    KN727613    KIH65309.1    KN549718    KHJ96244.1   
Pfam
PF00019   TGF_beta        + More
PF00431   CUB
PF13358   DDE_3
PF00292   PAX
PF00001   7tm_1
Interpro
IPR009057   Homeobox-like_sf        + More
IPR001839   TGF-b_C       
IPR029034   Cystine-knot_cytokine       
IPR017948   TGFb_CS       
IPR015615   TGF-beta-rel       
IPR000859   CUB_dom       
IPR035914   Sperma_CUB_dom_sf       
IPR038717   Tc1-like_DDE_dom       
IPR036388   WH-like_DNA-bd_sf       
IPR001523   Paired_dom       
IPR017452   GPCR_Rhodpsn_7TM       
IPR000276   GPCR_Rhodpsn       
SUPFAM
SSF46689   SSF46689        + More
SSF57501   SSF57501       
SSF49854   SSF49854       
Gene 3D
PDB
5CR4     E-value=5.25066e-08,     Score=131

Ontologies

Topology

Subcellular location
Secreted  
Length:
154
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.08234
outside
1  -  154
 
 

Population Genetic Test Statistics

Pi
73.919208
Theta
52.268392
Tajima's D
2.578847
CLR
0
CSRT
0.950302484875756
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号