SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11310
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Mitochondrial   Reliability : 3.707
 

Sequence

CDS
ATGGAAAACAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTTCCGATCCACTAACGGTGCTTCTAGGAACTTGGAAATTGGGCAAGGTTATCGCCTTGCCCAAACCCGGCAAGGACAGGAGAAATCCCTCCAGTTACCGTCCGATTACCTTGCTGTCGCACGTGGGCAAGTTGTTCGAGCGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCTTAGACCCGAGCAATTCGGGTTTCGTAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTTATGCATCACTTGGCGGATCGGTCCAACGCGCGCCAGTACGCGGCCGCAGTCTTTCTCGATATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGGTTCACAAGTTGTTGCAGAACACGGACCTCCAGCACGCCTACGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCCAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCTCAGGGGAGTGTCCTGGCACCACTCCTCTACGCTCTCTATACCAACGACATTCCCACGCTTGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCGCGTCATCCAACTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGCTATTGGACTTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACTGCGGCTATCCTCTTCGGTCCGGTCCGCACAACAGTCGTCCCGGGACAGCTCAGTCTCCGTGGCGCTAATGTCGAGTTTAGATCCAGCGTCCGGTACTTGGGGGTCGATATCGACCGGAGTTTGAGGATGACCGCCCACGCCATGTCGGCGTTGGCGGCCGCTCGTTACGCGAGATTCCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGGTCAGGACTAAGCTCGGCATTTATAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGGGTATGCGGGAGAGGTTACAGGTCCAGCAAAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGCCGTAATCGCCCAGGATCTGGATGTGGAGTCGCTCGAGGAGTTCATCCGGAGGCTAGCTCGTAATCTTTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATTTAGCTCCCTTGCACGCTAGACCACCTGATGGTCTGGCGCTACCAAGGGAGCTACTGGAACCCCCTTCTATGGTAAGATAG
Protein
MENSRRRPKHVISDPSDPLTVLLGTWKLGKVIALPKPGKDRRNPSSYRPITLLSHVGKLFERLLLRRVSPHILLRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYAAAVFLDIEKAFDRVWHAGLVHKLLQNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPLLYALYTNDIPTLEGNLQAWEADVKLALFADDSAYFASSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTTVVPGQLSLRGANVEFRSSVRYLGVDIDRSLRMTAHAMSALAAARYARFLLRPVLASRLPVRTKLGIYKTYVRSRITYAAAAWYHLIPQGMRERLQVQQNLALRTIVGAGRYVRNAVIAQDLDVESLEEFIRRLARNLYERADGGPHEHLHNLAPLHARPPDGLALPRELLEPPSMVR

Summary

EMBL
RSAL01000708    RVE41206.1    NWSH01000895    PCG73652.1    ABLF02017815    GGMR01004661    + More
MBY17280.1    ABLF02041767    ABLF02066620    GGMS01017914    MBY87117.1    ABLF02033522    ABLF02055645    ABLF02023911    ABLF02021177    ABLF02027367    ABLF02066338    ABLF02034467    KK117880    KFM71667.1    ABLF02008463    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    GEZM01074951    JAV64378.1    NEVH01017559    PNF23833.1    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    NEVH01023961    PNF17613.1    NEVH01003017    PNF40781.1    NEVH01018383    PNF23463.1    NEVH01000280    PNF43672.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01023962    PNF17612.1    NEVH01007443    PNF35684.1    NEVH01005938    PNF38077.1    GALX01005359    JAB63107.1    NEVH01020071    PNF21969.1    NEVH01001355    PNF42855.1    NEVH01010546    PNF32261.1    NEVH01019964    PNF22161.1    NEVH01014858    PNF27387.1    GGMS01004685    MBY73888.1    KK113014    KFM59099.1    NEVH01007838    PNF34986.1    NEVH01006754    PNF36554.1    ABLF02050434    ABLF02064867    ABLF02029306    ABLF02029314    ABLF02060138    NEVH01002716    PNF41415.1    NEVH01017470    PNF24199.1    NEVH01019376    PNF22596.1    KQ459259    KPJ02068.1    ABLF02017813    NEVH01009134    PNF33528.1    NEVH01021205    PNF19912.1    NEVH01027074    PNF13841.1    NEVH01026154    PNF14491.1    ABLF02010251    ABLF02035981    ABLF02040650    ABLF02040651    ABLF02056776    NEVH01011985    PNF31054.1    ABLF02003961    ABLF02059872    ABLF02028535    ABLF02028545    KK116883    KFM69009.1    KQ459265    KPJ02064.1    GGMR01019198    MBY31817.1    NWSH01000032    PCG80497.1    GEZM01008457    JAV94772.1    ABLF02014862    ABLF02014866    ABLF02061908    NEVH01019080    PNF22876.1    ABLF02042518    ABLF02057746    ABLF02025082    ABLF02039175    ABLF02041809    GALX01005299    JAB63167.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GBHO01041571    GBHO01005400    GBHO01005396    JAG02033.1    JAG38204.1    JAG38208.1    AB018558    BAA76304.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GBHO01041572    GBHO01041570    GBHO01010553    JAG02032.1    JAG02034.1    JAG33051.1    KQ971729    KYB24751.1    PCG80496.1    JXUM01155316    KQ572171    KXJ68070.1    KQ973342    KXZ75569.1    NEVH01000598    PNF43535.1    GFTR01008038    JAW08388.1    KK117974    KFM71881.1    AB055391    BAB21761.1    ABLF02008933    GEZM01053022    JAV74219.1    GFXV01005866    MBW17671.1    GGMS01012005    MBY81208.1    KK113137    KFM59425.1    GGMS01000737    MBY69940.1    GEZM01101506    JAV52621.1    NEVH01012084    PNF30905.1    JRES01000644    KNC29657.1    GEZM01101509    JAV52620.1    AF012049    AAC24972.1    NEVH01007393    PNF35987.1    NEVH01007578    PNF35646.1    NEVH01000269    PNF43694.1    U07847    AAA17752.1    GGMS01012393    MBY81596.1    IAAA01035747    LAA09607.1    GGMS01008766    MBY77969.1    GBBI01004571    JAC14141.1    NEVH01012089    PNF30491.1    NEVH01006721    PNF37225.1    GBHO01016496    JAG27108.1    ABLF02030319    ABLF02030320    NEVH01026386    PNF14434.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF03184   DDE_1
PF10551   MULE
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR004875   DDE_SF_endonuclease_dom       
IPR036875   Znf_CCHC_sf       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=1.87588e-05,     Score=115

Ontologies

Topology

Length:
440
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.12713
Exp number, first 60 AAs:
0.00419
Total prob of N-in:
0.03726
outside
1  -  440
 
 

Population Genetic Test Statistics

Pi
286.663152
Theta
165.756589
Tajima's D
4.296406
CLR
0.5129
CSRT
0.99970001499925
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号