SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11308
Pre Gene Modal
BGIBMGA001838
Annotation
PREDICTED:_uncharacterized_protein_LOC105387844_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 2.864
 

Sequence

CDS
ATGAAACGACACGATGCCATCACTAAAATGACGGAGCTAGTGCAGGAATACGATCCATCAGCGACCAGAGTGCACATTTTAAGAAAAATTGGGAGTCTACGGGCGTGCGTACGTAGGGAATACAAGCGCGTCCAAGAGAGTAGGAGGAAAGCTACTTGTGAAGAAGAAGTTTACGTTCCTAATCTGTGGTATTACGACTTACTGTCATTCATATTTAAGAACGAAGCGCCGGAGCCAGCAAGATCGCCTATCCCCACTGCTCGGGGCGGTGCGGCGGGGCGCGGGGGTCGAGCCACCGATTCGCCCAACCCAACCGCCAGCACGTTCAGTGACCTGCGCGACGCGCTGCTCGACGCACGCATCGGCATGTCGGAAGAAAACGTAGTGTTCCCACAAAAAATACTGAAGAAATTCATACTTTTATACAAAGATCTGCCGTGTTTGTGGGACAAAGAATGTCCAGCTTACAAAATCAAAATGAAACGACACGACGCCATCACTAAAATGACGGAGTTAGTGCAGGAATACGATCCGTCCGCGACCAGAGTGCACATTTTAAGAAAAATTGAGAGTCTACGGGCATGTGTTCGTAGGGAATACAAGCGCGTTCAAGAGAGCAGGAGGAAGGCTAATTGTGAAGAAGAAGTTTACGTTCCTAATCTGTGGTATTACGACTTACTGTCATTCATATTTAAGAACGAAGCGCCGGAGCCAGCAAGATCGCCTATCCCCACTGCTGAAACAGAGGAAGAAGAAGACGATGACTGTCAAGTGTTCGACAGCCAATCTGTGGACTACTCTAACGACTTTAACGAAACAGGGAACATGGTGGAAGCTGATGATGTGTCAACGATATCCAAAAGATATTTGACGTTTGAACCTGAATCTACAACTTCAAAAGTTAAGAGACAGTTTACTGAAGTGGAAGATGAATACGATGCAATTGAAATGGTGCTCACACGGTCCGAGAAGATGAGGTCGTCACGCCTTGACCGGCCCGGCAACGAAGCTGTCTCGGGCTCAACATCGCAAGACGCACAGCAACGAGCTGTGTCGGCCGCGCCGCGTTCGGGAGTGACGCAGGGACCGCCACCGATGGCGGCAACCTCCTCCCAGTCAACCGCGCCGCGTTCGGGAGTGACGCAGGGACCGCCACCGATGGCGGCACCCTCCTCCCAAGTGGAAAAGTGTCCGGGAGTGCCGCGGGGCTCACAAGCGATGCCCCCCTCCCGCCAAATATTGCCTACGCAATACTCGCCGGCGTCGCCAACGGGACCGAACAGCGGGGTCTGTCGTCGAGTGGTCAGACCTCCCAGCACCGCGACACCGGCAACAACTTCAGGCGACGCAGCAACGGAGAGCGTCGTATCCGCGAGCCAGAACAAGAAGGAGTCAGCGCTCGCGGCCAATCAAATAGTACACGGGTCCCACATCACGGACGCCGCTGCCAAAATCTCGACGACAGAAGAAGGCTCCACACTCCGCGACGGGATGGCGCCACCAGTACGAGGATCTTCAAGAAAGTCGAGTCAACAGTCACAACGGCTGTTGCTTATGGCGCGCCTCAAGGAAGAGCATCTTCGCGCCAAGGAAGAACAAGCCCGACTCCAAGCAGAGCTCGCCGCCGCCCGCATCTCAACATTAGAAGCCGAAGCGCTCGTTGAAGAGGAGGAAGATGCGCGCACAACACTCACGGAGGACGAGAACGAGCAATCGCAGCGCATCGATACATGGCTCAGTCAGCAACGATCGATCGCGCTACAGGGAGTCGAAGAAAGAGTAATGCAGCCAACACACGGATCACCAGCCACCATCGAGCAAAAGCAACTGGAACTTCCCGCACCAATAGAACAGCTGAAGCTACCGGCCCCTGCCGCGGCACCGATTGCCGTACCTGTCGCACCGAAGAGCGACATCGCCGAACTAGCAGCTGCCATCGCGACGGCCGCCCGCCAAGCCAGGCCCGGACCATCGCATCGGTACTACGGGGAGCTTCCAGTGTACAGTGGATCGCACCAAGAATGGCTCTCCTTCAAGGTCTCCTACGCCGAATCAGCGGACAGCTTCAGCGCCGCAGAGAACACTGCGAGACTTCGGCGTACGTTGAGAGGAAGAGCAAGAGAAGCGGTCGAAAACTTGTTGCTGCATTACACCGAGCCCGCCGAGATCATGCGGACTCTAGAATCGCGCTTCGGACGTCCAGAAGCAATCGCCGCAACGGAGCTGGAACGACTGCGCGCGCTGCCACGCTGCACGGACACACCGAGGGACATCTGCGTTTTCGCGAACAAGGTGAACAACGTCGTCGCCGCTCTGAGGGCCCTCGACCGCGTACATTATATGTACAACCCGGAGCTCACCAACATCACATCAGAGAAGCTGCCGTCCACTCTACGCCACCGCTGGTTCGAATTCTCAGCGACTCAACCGGCGGGAGAACCGGACCTCGTCAAGCTGTCGCGCTTCCTGCAACGCGAGGCGGACCTGTGCAGCCCATACGCACAGCCGGAGCCAGAGACGAGAGTGGAGAACACCAGCGGTCGGCGGAAGATGGTGAACACGCCTCAGAGGACGCACACCACGCAAGCGAAGGAAGAGAGGAAATGCGCAGCATGTCAGAAGCCGGGGCACATCCCACAAGATTGTCCCGAATTCAAGAGAGCAGCCGTCAGCGAGCGCTGGGATACGGCGAAGCGCGAGAATTTGTGTTTCCGGTGCCTACGGTTCCGGTCCCGGGGACACGTATGCAAAAAGAAGAAGTGCGGCGTCGACAGCTGCGAACGCACGCACCACGAGCTGTTGCATAAGAAGCCAGCATGGCAGAAGCCGAAAGAAAAAGAAGAGGCGGTCACCTCGACGTGGGCCGCAAGAAGTGCGACAGCCTACCTAAAGATGGCGCCAATTACCGTTATCGGACCGGCGGGAGAAGCAGATACATGGGCCCTGCTGGACGACGGGTCAACGATCTCGCTGATTGACGAAGACTTCGCGAGACGAGTGGGCGCCAAAGGACCGATCGAACCCCTCTTCATCACTGCCATCGGAGACAATAAGATAGACGCAACACGCTCACGACGCGTCCCGCTGAAGCTATGCGGACGCACGGGGGAACCGCAAGAACTGAACCTACGGACAGTCAACGGCTTAAAATTAACACCACAGCGACTGAACATCGAAGTCCTCGCGTCGTGCCATCACCTCACCGACCTCCGCCATCACTTCAAAACGAGCTACGCCTCGCCGAAGATCCTGATCGGCCAAGACAACTGGCACCTGCTGGTGACGGAGGAGATGCGGACGGGACGACGCGATCAACCAGTGGCGTCTCGTACTCCACTCGGGTGGGTCGTGCACGGAGCACACCCGGGAGGCAAGAGACAGCGCGTCAACTTCGTGGGACACGCGACGACGGTCGACACGAACATGGACGAAGCCCTCAAACAGTACTTCGCGATCGAGGGACCCACCGTCGCCGCCAAGACGCCGAAGAATGACCCAGACGAGCGCGCGCTGAAGATCCTGCGAGAGACCACTCAACAGCGACCCGGCGGCCGCTACGAGACCGCACTGCTGTGGCGTGAGGAGGGCCTGAAGATGCCCAACAATCTTGAAGCCGCAATGAATCGCCTGACGTCCGTAGAGAAGAAACTGGAGAAGGATCCAAATTTGAAAGAGCGCTACAAGCAACGAACAAACGCACTGGTAGCAAAAGGATACGCCGAAGTAACTCCGTCGACGGAGGGAAGAAGCCCAAACGACTTCCTGCTCACCGACCCGGACCTGCTGCAGTCGCTGCCCGGAGCGATGATGCGCTTCAGGCAGCACGCCGTTGCCGTCTCCACGGACATCGCGGAGATGTTCATCCAGATAGGCGTCCGAAGCGAGGACCGCGACGCGCTCCGGTACTTGTGGAGGGAGAACCCTTCACGAGAACCTATAGAATACCGGATGAGGTCCATCGTCTTTGGCGCGACAAGCTCGCCTGCAACCACCATCTGCGTGAAGAACCGACTGCAGTACCCGGACGCCGCCGACCTCAAGCTCCACACGTACGTGGACACGAGCAAGTACGCCCACGACGCCGCGTTGTACTGGCGCGTGGAGACGCCCGACGGGGAGATGAGGACCTCCCTCGCCAAAGCCCGAGTCGCACCCATGAAGCTAACATCGATACTGCATCTCGAGCTACAAGCCGCCGTGATGAGCAGCCGCATGGCCGCGGCCGTCACGGAAGAACACAATAGAAAGCCAGACAAGAGTGTTCTGGACAGACAGCGCCACCGTATTGACCTGGCTGCGAACGGGGTCGAGGTCGTATCGACCGTTCGTCGCTCACCGCATTGCAGCGATAGAAGAGAACAGCACTGTGGAGGAATGGCGCTGGGCCCGGAATACCTAAGACGGCATCCGGATGATTGGCCCGTACAACGGACTGCAAGAAGAGCAGAAGAGACGGGCGAAGAGAAGTGCGCAATGCTCGCCGTGAGCAGAGAGAGCCTCGGCGAAGCGATCCCGGACCCAAGACGCTTCTCCAAGTGGGAGAAGTACCTGCGTGCAACGGGGCGAATACTGCAATTCGTCGACCTATGCCGCAGAAGTCGCGAGCGCACTTATTACAAGAGGACCAGACGGAACCCGCGCTCGGACCCGACGTGGGAGAGAAATAGAAAGAAGACGACTTCGAAGACCCCGCTGAACACACCGCGGACGCCAGAGCAAGCAGTCATTCAATGGAAGACTTTAGACGCCGACACGCTTCGACGCGCCGAGACGCTCATTTGGCAACAGAGCCAGCGGGCAGCCTTCGAGGAAGAGATTTTGACGCTCCAGCGAGGGAAACAGATATCCCCAGCGAGCCGACTGCGAAACTTGTCCGTAACTTACGCGGACGGGATACTGAAAATAAACGGACGCATCGGCAACATAGAGGGAGCTGACGTCATCACCTCGCCTCTCGTGCTAGACGGATCCCGACGCGAAACGAGACTGATGATAGACTTCATCCATAGAAAGATGCACCACGCCGGAACCGAAGCTACGATCGCCGAGTGCCGACAGTCGTACTGGGTCTTACGCCTACGCCCAGTGACACGGAGCGTGATCCACAATTGTCTTCCGTGTCGTATCCGCAAGGACACTCCACCGCGTCCAGCCACAGGCGACCACCCACCGAGCAGACTGGCACACCATCGGCGACCATTTACATACGTGGGCCTCGATTACTTCGGGCCCTACCAAGTTACCACCGGCAGAAGCACCCAGAAGCACTACGTGGCCATCTTCACATGTCTCACTACGCGTGCGATACATTTAGAACCGGCAGCGAGCCTCAGCACGGACTCAGCAGTGATGGCACTCCGGCGCATGATCGCGCGCCGGGGAGCTCCGACGGAAGTATGGAGCGACAACGGCACCAACTTACGAGGTGCCGACAAGGAGCTGCGCCAAGCTATGGACAAGGCGACTGAGCATGAAGCGAGCTTAAGGCTTATACAATGGCGCTTCATCCCACCGGGCGCGCCTTTCATGGGCGGCGCCTGGGAGAGAATGGTACGGGCAGTAAAGGCCGCGCTCTCGGCCACGGAACAGACGAGGCACCCGACGCCCGAAATATTTCATACTCTGTTAGCAGAGGCAGAGTTCACAGTGAACAGCCGACCTCTCACCCATGTATCGGTGAGCGCCGACGATCCCGACCCTCTGACACCGAACCACTTCCTGCTGGGAGGCCCGGCGCGAGTCCCCGTGCCGGGCAAATTTGACGACGCCGACCTCATAGGGCGCGCACACTGGCGCGCAGCACAACGTCTGGCAGATGTGTTCTGGAGTCGCTGGCTCCGGGAGTACCTGCCCGACCTGCAGAACCGGCGGGAGCCCCACAGCCGCGGGCCCGCCCTGAAGATAGGCGACGTCGTGATAATAGCAGACGGAACGCTCCCACGGAACACCTGGCCACGTGGGATCATCCAGGAGGTTTACCCGGGGGCCGACGGCATCACTCGAGTGGTCGACGTACGCACCGCCGGCGGTATATTGCGACGCCCGGCAAAGAAGATCATCGTGCTGCCCACGATGTCCGCCGCTCACCAGGGAGGATGCAGCGACGTGAACGACGCTGCACGGCGGGAGGATGTTCGCGACGGACATGAATGA
Protein
MKRHDAITKMTELVQEYDPSATRVHILRKIGSLRACVRREYKRVQESRRKATCEEEVYVPNLWYYDLLSFIFKNEAPEPARSPIPTARGGAAGRGGRATDSPNPTASTFSDLRDALLDARIGMSEENVVFPQKILKKFILLYKDLPCLWDKECPAYKIKMKRHDAITKMTELVQEYDPSATRVHILRKIESLRACVRREYKRVQESRRKANCEEEVYVPNLWYYDLLSFIFKNEAPEPARSPIPTAETEEEEDDDCQVFDSQSVDYSNDFNETGNMVEADDVSTISKRYLTFEPESTTSKVKRQFTEVEDEYDAIEMVLTRSEKMRSSRLDRPGNEAVSGSTSQDAQQRAVSAAPRSGVTQGPPPMAATSSQSTAPRSGVTQGPPPMAAPSSQVEKCPGVPRGSQAMPPSRQILPTQYSPASPTGPNSGVCRRVVRPPSTATPATTSGDAATESVVSASQNKKESALAANQIVHGSHITDAAAKISTTEEGSTLRDGMAPPVRGSSRKSSQQSQRLLLMARLKEEHLRAKEEQARLQAELAAARISTLEAEALVEEEEDARTTLTEDENEQSQRIDTWLSQQRSIALQGVEERVMQPTHGSPATIEQKQLELPAPIEQLKLPAPAAAPIAVPVAPKSDIAELAAAIATAARQARPGPSHRYYGELPVYSGSHQEWLSFKVSYAESADSFSAAENTARLRRTLRGRAREAVENLLLHYTEPAEIMRTLESRFGRPEAIAATELERLRALPRCTDTPRDICVFANKVNNVVAALRALDRVHYMYNPELTNITSEKLPSTLRHRWFEFSATQPAGEPDLVKLSRFLQREADLCSPYAQPEPETRVENTSGRRKMVNTPQRTHTTQAKEERKCAACQKPGHIPQDCPEFKRAAVSERWDTAKRENLCFRCLRFRSRGHVCKKKKCGVDSCERTHHELLHKKPAWQKPKEKEEAVTSTWAARSATAYLKMAPITVIGPAGEADTWALLDDGSTISLIDEDFARRVGAKGPIEPLFITAIGDNKIDATRSRRVPLKLCGRTGEPQELNLRTVNGLKLTPQRLNIEVLASCHHLTDLRHHFKTSYASPKILIGQDNWHLLVTEEMRTGRRDQPVASRTPLGWVVHGAHPGGKRQRVNFVGHATTVDTNMDEALKQYFAIEGPTVAAKTPKNDPDERALKILRETTQQRPGGRYETALLWREEGLKMPNNLEAAMNRLTSVEKKLEKDPNLKERYKQRTNALVAKGYAEVTPSTEGRSPNDFLLTDPDLLQSLPGAMMRFRQHAVAVSTDIAEMFIQIGVRSEDRDALRYLWRENPSREPIEYRMRSIVFGATSSPATTICVKNRLQYPDAADLKLHTYVDTSKYAHDAALYWRVETPDGEMRTSLAKARVAPMKLTSILHLELQAAVMSSRMAAAVTEEHNRKPDKSVLDRQRHRIDLAANGVEVVSTVRRSPHCSDRREQHCGGMALGPEYLRRHPDDWPVQRTARRAEETGEEKCAMLAVSRESLGEAIPDPRRFSKWEKYLRATGRILQFVDLCRRSRERTYYKRTRRNPRSDPTWERNRKKTTSKTPLNTPRTPEQAVIQWKTLDADTLRRAETLIWQQSQRAAFEEEILTLQRGKQISPASRLRNLSVTYADGILKINGRIGNIEGADVITSPLVLDGSRRETRLMIDFIHRKMHHAGTEATIAECRQSYWVLRLRPVTRSVIHNCLPCRIRKDTPPRPATGDHPPSRLAHHRRPFTYVGLDYFGPYQVTTGRSTQKHYVAIFTCLTTRAIHLEPAASLSTDSAVMALRRMIARRGAPTEVWSDNGTNLRGADKELRQAMDKATEHEASLRLIQWRFIPPGAPFMGGAWERMVRAVKAALSATEQTRHPTPEIFHTLLAEAEFTVNSRPLTHVSVSADDPDPLTPNHFLLGGPARVPVPGKFDDADLIGRAHWRAAQRLADVFWSRWLREYLPDLQNRREPHSRGPALKIGDVVIIADGTLPRNTWPRGIIQEVYPGADGITRVVDVRTAGGILRRPAKKIIVLPTMSAAHQGGCSDVNDAARREDVRDGHE

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
2050
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00540999999999998
Exp number, first 60 AAs:
0.00096
Total prob of N-in:
0.00025
outside
1  -  2050
 
 

Population Genetic Test Statistics

Pi
209.397007
Theta
153.836557
Tajima's D
1.332333
CLR
0.581364
CSRT
0.747212639368032
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号