SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11284
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.51
 

Sequence

CDS
ATGGAAGAAATAATAACCACCCTACGCTTAATTCAAAAAGATCTCGAAGACCAAAAAATCGCAATAAAGGAAAGCGGTATAGAAGTTGCAAAAACAGTTACGGATAATGTGAATCTGATTTTAGACGAAAAACTAAGTCAACTTGAACAAAAATATAAAACCCTAGAAGAACAATTTGAAATGCAGGAACAAAGACTTCATATATTGGAGAAACAGGCAAGAAATCGAAATATTGTATTTTTTGGCATTGAAGAACACAACTCAATCTACTCTTACTCGGATTTAGAAACGGAAATTATTAATTTCACATCAAAATATCTGGGAATCAAACTAGACCGAAAAGAAATTCAAGAAATCAGAAAAATAGGGAAAAATACAAAGAAACCTAGGCCTATTGTTATGACACTGACCACAGTTGGTAGAAAAATTGAAATTCTCAAACAAAAGAAGCTATTGAAGGATTCAAACTACTACATTAAGGAAGATTACCCACAGCATATTCTAGAGAAACGGAGAATGCTACAGGAACAAGTAAAAGTTGAAAGAGATAAGGGTAACAAAGCTATATTAAAATACGATAAAATAGTTATAATAGGAAAACAAGAAATAAATAATAAATTAGGAAAGAGTAAACGATCTCTCCCGACATCGCCTCCAGAAACCGATAATCGCATTGATTCATCACCTAGAACTCAACCAAAAAAGAAAAACAAACCTGCATCAAACACCTCACAGGGCACAACTAGTTGTTCTGAAAATATAGTCAAGGCAGGGATCTTCAACTATTTGGAATCATACAACAATACCGAAAATAATAATATAAACTATATAGAGGAACTTGAGATTATACAAGCAGCTGATAAGTTAAAATTTGAGAAGAGCCCAGGCCCAGATTTCATTACTAATGAAGCAATCAAACATGGATGTGAAATACTTGCATCACCACTGGCCTCATTATTTAATCTGATACTCAAAACTGCGAATATACCTGCACAATGGTCAGAATCCATTATAATCTTGCTGTATAAAAAAGGTAACCCTAATGACATTAGCAATTACAGGCCAATAAGCCTTTTGGCAACTGTTTACAAGCTTTTCTCTTCCATAATTAATCGAAGAATATCTGAAACTTTAGAAAAGAGACAGCCCATAGAGCAAGCTGGCTTCCGTAAGGGATATTTAACCGTAGACCACATACACACGCTGGAACTTATTATCGAAAAATACCAAGAGAAGCAAAGACCGCTCTATATAGCTTTTATAGATTACCAGAAGGCTTTCGACACAATTTCACACACAAGCATATGGGAGGCATTAAATCAACAAGGAGTGGAAAGTGAGTATATACAAGTTATAAAAAATATATATAAGAACAGTGTCAGTAAAGTCAAACTGGAAACAATTGGCCCTGATTTTAACATCAATAGAGGAGTGAGACAAGGGGATCCATTGTCTCCAAAACTATTTATTGCAGTATTGGAATCAATTATAAGTCAATTAGACTGGAAAAACTATGGCTTGTATATCAAAGGTGACTGCTTAAGTCATCTAAGGTTCGCAGATGACTTAGTACTGCTATCTGAAACCGGTGGTAACTTAGAGCGCATGATACAGTCATTACACGAAGCTAGCAGACAAGTCGGATTAGAAATTAATCTGAAAAAAACAAACATCATGACAAACAGTTGTAGAAGAACCATCTCACTAGAACACAAACCAATACTGTACGTGGAACAATATATCTACTTAGGAAAGCAGATAGCACTGGACAACAATAGCAATGAACTAGAGGTGGAGCGCAGAACAAGAATTACGTGGAATAAGTTCTGGAGTTACAGAGAAGTAATGAAAAGTAACATGCCAACAGAAGTGAAAAAGAAAATCATGGACACTTGTATATTGCCGTGTCTTACATACGGTTGCCAGACGTGGAAATTTACGCGTAACATTAAAAATAAATTAACAACGTGCCAGAGGGGAATGGAACGCAGCATGCTCAACATAAAAAAGACACACAGAGTGCGTCATACAAAGATAAGAAGCATAACCAAAACAGTGGACGCTCTCAAATATGCTCAAAGACTGAAGTTTAAGTGGGCTGGCCACGTAGCACGACTCAGGGATGGGAGATGGACATCGAAAGTAACTGCATGGGACGGTCCACAGGGCAAGCGGCGCGTCGGCAGACCGTACACGCGTTGGGAGGATGATATTAGAAAGGTTGCTGGACCACACTGGATTTATGTCGCCAGAGACAAAGCAGAGTGGAAATCTTTGGAGGAGGCCTTTACCTGA
Protein
MEEIITTLRLIQKDLEDQKIAIKESGIEVAKTVTDNVNLILDEKLSQLEQKYKTLEEQFEMQEQRLHILEKQARNRNIVFFGIEEHNSIYSYSDLETEIINFTSKYLGIKLDRKEIQEIRKIGKNTKKPRPIVMTLTTVGRKIEILKQKKLLKDSNYYIKEDYPQHILEKRRMLQEQVKVERDKGNKAILKYDKIVIIGKQEINNKLGKSKRSLPTSPPETDNRIDSSPRTQPKKKNKPASNTSQGTTSCSENIVKAGIFNYLESYNNTENNNINYIEELEIIQAADKLKFEKSPGPDFITNEAIKHGCEILASPLASLFNLILKTANIPAQWSESIIILLYKKGNPNDISNYRPISLLATVYKLFSSIINRRISETLEKRQPIEQAGFRKGYLTVDHIHTLELIIEKYQEKQRPLYIAFIDYQKAFDTISHTSIWEALNQQGVESEYIQVIKNIYKNSVSKVKLETIGPDFNINRGVRQGDPLSPKLFIAVLESIISQLDWKNYGLYIKGDCLSHLRFADDLVLLSETGGNLERMIQSLHEASRQVGLEINLKKTNIMTNSCRRTISLEHKPILYVEQYIYLGKQIALDNNSNELEVERRTRITWNKFWSYREVMKSNMPTEVKKKIMDTCILPCLTYGCQTWKFTRNIKNKLTTCQRGMERSMLNIKKTHRVRHTKIRSITKTVDALKYAQRLKFKWAGHVARLRDGRWTSKVTAWDGPQGKRRVGRPYTRWEDDIRKVAGPHWIYVARDKAEWKSLEEAFT

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
5HHL     E-value=0.0374914,     Score=89

Ontologies

Topology

Length:
764
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0019
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00011
outside
1  -  764
 
 

Population Genetic Test Statistics

Pi
238.691329
Theta
24.850189
Tajima's D
1.754092
CLR
0.092629
CSRT
0.844857757112144
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号